A DNA strand was sequenced using the Sanger method(https://www.youtube.com/watch?v=KTstRrDTmWI). The reactiontube contained the DNA strand, fluorescently labelleddideoxynucleotide triphosphates (ddATP – yellow, ddGTP – green,ddCTP – blue, ddTTP - red), deoxynucleotide triphosphates, DNApolymerase, or its Klenow fragment. Synthesis of DNA is allowed toproceed, and the results are shown on the right:151413121110(a) What is the sequence of the copy and the template strands?(b) If the template strand were in the 5'-3' direction, what will bethe sequence of the DNA copy?Nucleotide Length

A DNA primer complementary to the template DNA (the DNA to be sequenced) is used as a starting point…

Answered: a) What is the sequence of the copy and…

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: bottom strand is the noncoding strand). 5'-ААCGCATGAGAAAGCCCCCCGGAAGATCACСТТСCGGGGGCТТТАТАТААТТАGC-3' 3'-тTGCGTACтстттCGGGGGGCCTTCTAGTGGAAGGCCCCCGАААТАТАТТААТтCG-5' (i) Draw the structure of hairpin loop that will be formed during transcription. (ii) Illustrate how the hairpin loop structure initiates the termination of transcription.
A Sanger product of the sequencing of a template DNA is presented +ddTTP +ddATP +ddCTP +ddGTP Mononucleotide Pentanucleotide Trinucleotide Dinucleotide 11-nucleotide Hexanucleotide Octanucleotide Tetranucleotide 16-nucleotide Decanucleotide Nonanucleotide Heptanucleotide 17-nucleotide 15-nucleotide 13-nucleotide 12-nucleotide 18-nucleotide 20-nucleotide 14-nucleotide 19-nucleotide 21-nucleotide 1. Determine the sequence of template DNA 2. Determine the mRNA sequence from this template DNA 3. Determine the the sequence of protein product derived from that DNA
The chromatogram shows fluorescent peak data from a dye-terminating nucleotide-sequencing reaction. The peaks are shown with shortest fragment on the left to longer fragments on the right. T •C A Select the DNA sequence that matches the data. 5-ТАТAСТТАСGAAGT-3' 5'-GTCCTACGGACGCG–3' 5'-ATATGAATGCTTCA–3' 5'-TGAAGCATTCATAT–3' 5-АСТТCGTAAGTATA-3'
There are 6 parts to this question: This is a follow up to the prior question regarding the replication of the DNA strand below. The DNA strand is here for your reference and you do not need to do anything with or to it. TC GATATCGG AGCTATAGCC c) what enzyme separated the parental DNA template strands, d) what bonds were broken? e) what enzyme replicates DNA f) before DNA can be replicated/copied, what must be laid down to allow the enzyme in "e" to replicated the DNA (be specific)? g) our DNA is replicated in many "pieces", what enzyme connects these many "pieces" into one continuous DNA strand that becomes the sister chromatid? h) during what specific phase of the cell cycle does this DNA replication process occur? (This should be a review question from last topics we covered).
Is there any situation in which DNA is made based on a RNA template? What is the enzyme involved?
Given the DNA template strand 3' GCATTCAAG 5', write the amino acid sequence in the N‑terminal to C‑terminal direction. Note: Enter the amino acids using their three-letter designations. Put a hyphen between each amino acid.
What is generated from the replication of DNA ? what method is used ? Describe the process. What are Okazaki fragments? What enzymes are used ?
Make the complementary strand for the following DNA template and label both strands as 5’ to 3’ or 3’ to 5’ (hint: determine first if P = phosphate or –OH are the 5’ or 3’ end of the strand). Draw an arrow showing the direction of synthesis of the new strand. How many total hydrogen bonds are in this double strand of DNA? Template : P- AGACTTG-OH New strand :
Kornberg and his colleagues incubated soluble extracts of E. coli with a mixture of dATP, dTTP, dGTP, and dCTP, all labeled with 32P in the alpha-phosphate group. After a time, the incubation mixture was treated with trichloroacetic acid, which precipitates the DNA but not the nucleotide precursors. The precipitate was collected, and the extent of precursor incorporation into DNA was determined from the amount of radioactivity present in the precipitate. (a) If any one of the four nucleotide precursors were omitted from the incubation mixture, would radioactivity be found in the precipitate? Explain within 2 sentences. (2) (b) Would 32P be incorporated into the DNA if only dTTP were labeled? Explain within 2 sentences. (2) (c) Would radioactivity be found in the precipitate if 32P labeled the β or γ phosphate rather than the α phosphate of the deoxyribonucleotides? Explain within 2 sentences. (2)
For the following short sequence of double stranded DNA and the given primers, there will be one major duplex DNA product after many cycles (imagine 10 cycles) of PCR. Provide the sequence of this one major duplex product and label the 5’ and 3’ ends of each strand. Sequence to be amplified: 5’- GGTATTGGCTACTTACTGGCATCG- 3’ 3’- CCATAACCGATGAATGACCGTAGC- 5’ Primers: 5’-TGGC-3’ and 5’-TGCC-3’
The following DNAs were incubated with E. coli DNA Polymerase I and dNTPs. Write the products expected in each reaction. Indicate the activity used in each reaction.
Sanger sequencing originally used 4 lanes in gels. These lanes represented sequences of different lengths obtained by adding: All of the 4 dideoxynucleotides (ddATP; ddGTP; ddCTP; ddTTP), together with all of the 4 deoxynucleotides (dATP, dGTP, dCTP and dTTP), to all of the reaction vials All of the 4 dideoxynucleotides (ddATP; ddGTP; ddCTP; ddTTP) to the reaction vials; together with one of the 4 deoxynucleotides (dATP, dGTP, dCTP and dTTP), one for each lane, in each vial. One of the 4 dideoxynucleotides (ddATP; ddGTP; ddCTP; ddTTP) to the reaction vials; one for each lane, together with all of the 4 deoxynucleotides (dATP, dGTP, dCTP and dTTP) in each vial One of the 4 dideoxynucleotides (ddATP; ddGTP; ddCTP; ddTTP) to the reaction vials; one for each lane

SEE MORE QUESTIONS

Recommended textbooks for you

Biochemistry

ISBN:

9781319114671

Author:

Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:

W. H. Freeman

Lehninger Principles of Biochemistry

Biochemistry

ISBN:

9781464126116

Author:

David L. Nelson, Michael M. Cox

Publisher:

W. H. Freeman

Fundamentals of Biochemistry: Life at the Molecul…

Biochemistry

ISBN:

9781118918401

Author:

Donald Voet, Judith G. Voet, Charlotte W. Pratt

Publisher:

WILEY

Biochemistry

ISBN:

9781319114671

Author:

Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:

W. H. Freeman

Lehninger Principles of Biochemistry

Biochemistry

ISBN:

9781464126116

Author:

David L. Nelson, Michael M. Cox

Publisher:

W. H. Freeman

Fundamentals of Biochemistry: Life at the Molecul…

Biochemistry

ISBN:

9781118918401

Author:

Donald Voet, Judith G. Voet, Charlotte W. Pratt

Publisher:

WILEY

Biochemistry

ISBN:

9781305961135

Author:

Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal

Publisher:

Cengage Learning

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

Fundamentals of General, Organic, and Biological …

Biochemistry

ISBN:

9780134015187

Author:

John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson

Publisher:

PEARSON

SEE MORE TEXTBOOKS

a) What is the sequence of the copy and the template strands? b) If the template strand were in the 5'-3' direction, what will be the sequence of the DNA copy?