The DNA STRAND IS 3’ TAC-AGC-ACT-CAG-TCA 5’ and Non-template strand = 5' - ATG-TCG-TGA-GTC-AGT - 3' . If on the non-coding strand of DNA there is suddenly one T base that sneaks into the 4th sequence (from the left), or causes a mutation, then how will the RNA be formed and the chain arrangement of the amino acids produced by this mutation? 4th sequence (from the left) should be = TCG right?

The DNA STRAND IS 3’ TAC-AGC-ACT-CAG-TCA 5’ and Non-template strand = 5' - ATG-TCG-TGA-GTC-AGT - 3' . If on the non-coding strand of DNA there is suddenly one T base that sneaks into the 4th sequence (from the left), or causes a mutation, then how will the RNA be formed and the chain arrangement of the amino acids produced by this mutation? 4th sequence (from the left) should be = TCG right?

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter8: The Structure, Replication, And Chromosomal Organization Of Dna

Section: Chapter Questions

Problem 14QP: State the properties of the WatsonCrick model of DNA in the following categories: a. number of...

See similar textbooks

Similar questions

Using Figures 8.7 and 8.9 as a guide, draw a dinucleotide composed of C and A. Next to this, draw the complementary dinucleotide in an antiparallel fashion. Connect the dinucleotides with the appropriate hydrogen bonds. FIGURE 8.9 The two polynucleotide chains in DNA run in opposite directions. The left strand runs 5 to 3, and the right strand runs 3 to 5. The base sequences in each strand are complementary. An A in one strand pairs with a T in the other strand, and a C in one strand is paired with a G in the opposite strand. FIGURE 8.7 Nucleotides can be joined together to form chains caled polynucleotides. Polynucleotides are polar molecules with a 5 end (at the phosphate group) and a 3 end (at the sugar group). An RNA polynucleotide is shown at the left, and a DNA polynucleotide is shown at the right.
State the properties of the WatsonCrick model of DNA in the following categories: a. number of polynucleotide chains b. polarity (running in same direction or opposite directions) c. bases on interior or exterior of molecule d. sugar/phosphate on interior or exterior of molecule e. which bases pair with which f. right- or left-handed helix
What are the base-pairing rules for DNA? a. A-G, T-C c. A-T, G-C b. A-C, T-G d. A-A, G-G, C-C, T-T
The DNA STRAND IS 3’ TAC-AGC-ACT-CAG-TCA 5’, and Non-template strand = 5' - ATGTCGTGAGTCAGT - 3' . If on the non-coding strand of DNA there is suddenly one T base that sneaks into the 4th sequence (from the left), or causes a mutation, then how will the RNA be formed and the chain arrangement of the amino acids produced by this mutation?
Here is a DNA coding strand’s sequence and direction: 5’-ATGCCGATATAG-3’ . What would be the amino acid sequence in the polypeptide encoded by this DNA?
If the DNA sequence A-T-T-G-G-C-C-T-A on an informational strand mutated and became A-C-T-G-G-C-C-T-A, what effect would the mutation have on the sequence of the protein produced?
What is the nucleotide sequence of the complementary strand of the DNA molecule: 5’-AATGCGATCTTCAT-3’? Indicate the 5’ and 3’ ends. Follow the same format as the given sequence.
A segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following segment of DNA: G G C T A G C T G C T T C C T T G G G G A C C G A T C G A C G A A G G A A C C C C T Template strand with its polarity: 3’ C C G A T C G A C G A A G G A A C C C C T 5’ - Coding strand with its polarity: 3’ G G C T A G C T G C T T C C T T G G G G A 5’ Please write out the mRNA sequence generated by the template strand to produce that polypeptide chain.
DNA STRAND IS 3’ TAC-AGC-ACT-CAG-TCA 5’a. what is the non-template/sense/coding strand?b. What is the arrangement of the m-RNA?c. What's the chain arrangement of the amino acids that will be made according to the order of the RNA?d. If on the non-coding strand of DNA there is suddenly one T base that sneaks into the 4th sequence (from the left), or causes a mutation, then how will the RNA be formed?e. What's the chain arrangement of the amino acids produced by this mutation?
As you should recall, DNA, when not being actively transcribed, has a double helical structure. This portion of the DNA has had the two strands separated in preparation of transcribing for a needed protein. The following is one of the two complimentary strands of DNA: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5' Q: Based on written convention, i.e. the 3'-5' orientation, is this the coding strand or the template strand? ______________________________ Q: Assuming this strand extends from base #1 to #61 (going left to right), interpret the correctly transcribed mRNA and translated polypeptide for bases 24 - 47: mRNA: ___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___- polypeptide chain: ________--________--________--________--________--________--________--________
Write the complementary strand to the following single-stranded DNA and label the 5' and 3' ends: 5'-ATAGCATGGGCCATACGATTACTGA-3'
Give the complimentary DNA strand for the following:ACG TAG CTA GTC AGT CGT AGC Give the RNA strand for the following:ACG TAG CTA GTC AGT CGT AGC Using the provided amino acid table and the RNA strand you created in #2, create the amino acid sequence: Name and explain two different ways in which DNA can be damaged. Once DNA is damaged, can we repair it? If not, what are some possible outcomes from the damaged DNA?