Genetics: From Genes to Genomes
6th Edition
ISBN: 9781259700903
Author: Leland Hartwell Dr., Michael L. Goldberg Professor Dr., Janice Fischer, Leroy Hood Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 11, Problem 10P
Using PCR, you want to amplify an approximately 1 kb exon of the human autosomal gene encoding the enzyme phenylalanine hydroxylase from the genomic DNA of a patient suffering from the autosomal recessive condition phenylketonuria (PKU).
a. | Why might you wish to perform this PCR amplification in the first place, given that the sequence of the human genome has already been determined? |
b. | Calculate the number of template molecules that are present if you set up a PCR reaction using 1 nanogram(1 × 10-9 grams) of chromosomal DNA from blood cells as the template. Assume that each haploid genome contains only a single gene for phenylalanine hydroxylase and that the molecular weight of a base pair is 660 grams per mole. The haploid human genome contains 3 × 109 base pairs. |
c. | Calculate the number of PCR product molecules you will obtain if you perform 25 PCR cycles and the yield from each cycle is exactly twice that of the previous cycle. What would be the mass of these PCR products taken together? |
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
Describe the possible outcome of a PCR experiment in which (a) there is a single-stranded break in the target DNA sequence, which is present in only one copy in the starting sample, and (b) there is a doublestranded break in the target DNA sequence, which is present in only one copy in the starting sample.
A researcher is interested in using the in vitro technique of bisulfite conversion to confirm the
methylation status of a DNA sequence.
A. In vitro Sodium bisulfite treatment of DNA results in what type of chemical reaction?
i. Which bases are preferentially affected?
B. What nucleotide change is expected immediately following sodium bisulfite treatment
of the DNA?
C. You analyze the following DNA sequence before bisulfite treatment and after bisulfite
treatment followed by a 30-cycle PCR reaction. Based on sequence comparison, how
many cytosines were unmethylated in the original DNA sequence? Briefly explain how
you came to this conclusion.
Before bisulfite treatment:
After bisulfite treatment and a 30-cycle PCR reaction:
5' CGACGCGCGATTCATTCGATT 3'
5' TGACGCGTGATTTATTTGATT 3'
Polymerase Chain Reaction (PCR) was invented by Kary Mullis in 1983. This technique had
indeed facilitated research in various areas of molecular biology and genetics. You would like
to amplify a particular gene fragment from the yeast genome using Polymerase Chain Reaction
(PCR). What are the THREE (3) main cycles in PCR? Discuss the processes at each PCR cycle
mentioned.
Chapter 11 Solutions
Genetics: From Genes to Genomes
Ch. 11 - Choose the phrase from the right column that best...Ch. 11 - Would you characterize the pattern of inheritance...Ch. 11 - Would you be more likely to find single nucleotide...Ch. 11 - A recent estimate of the rate of base...Ch. 11 - If you examine Fig. 11.5 closely, you will note...Ch. 11 - Approximately 50 million SNPs have thus far been...Ch. 11 - Mutations at simple sequence repeat SSR loci occur...Ch. 11 - Humans and gorillas last shared a common ancestor...Ch. 11 - In 2015, an international team of scientists...Ch. 11 - Using PCR, you want to amplify an approximately 1...
Ch. 11 - Prob. 11PCh. 11 - The previous problem raises several interesting...Ch. 11 - You want to make a recombinant DNA in which a PCR...Ch. 11 - You sequence a PCR product amplified from a...Ch. 11 - Prob. 15PCh. 11 - The trinucleotide repeat region of the Huntington...Ch. 11 - Sperm samples were taken from two men just...Ch. 11 - Prob. 18PCh. 11 - a. It is possible to perform DNA fingerprinting...Ch. 11 - On July 17, 1918, Tsar Nicholas II; his wife the...Ch. 11 - The figure that follows shows DNA fingerprint...Ch. 11 - Microarrays were used to determine the genotypes...Ch. 11 - A partial sequence of the wild-type HbA allele is...Ch. 11 - a. In Fig. 11.17b, PCR is performed to amplify...Ch. 11 - The following figure shows a partial microarray...Ch. 11 - Scientists were surprised to discover recently...Ch. 11 - The microarray shown in Problem 25 analyzes...Ch. 11 - The figure that follows shows the pedigree of a...Ch. 11 - One of the difficulties faced by human geneticists...Ch. 11 - Now consider a mating between consanguineous...Ch. 11 - The pedigree shown in Fig. 11.22 was crucial to...Ch. 11 - You have identified a SNP marker that in one large...Ch. 11 - The pedigrees indicated here were obtained with...Ch. 11 - Approximately 3 of the population carries a mutant...Ch. 11 - The drug ivacaftor has recently been developed to...Ch. 11 - In the high-throughput DNA sequencing protocol...Ch. 11 - A researcher sequences the whole exome of a...Ch. 11 - As explained in the text, the cause of many...Ch. 11 - Figure 11.26 portrayed the analysis of Miller...Ch. 11 - A research paper published in the summer of 2012...Ch. 11 - Table 11.2 and Fig. 11.27 together portray the...Ch. 11 - The human RefSeq of the entire first exon of a...Ch. 11 - Mutations in the HPRT1 gene in humans result in at...Ch. 11 - Prob. 44P
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- You are tasked with amplifying a gene of interest with PCR. a. After performing a Southern blot, you see no signal on your gel. What could have happened with your PCR? b. After troubleshooting your PCR, you now want to perform Reverse Transcriptase (RT) PCR to look at MRNA expression. Assuming the primers in 2a were not the problem for your DNA and using the same primers as 2a, you see no signal on your Southern blot. What are possible causes?arrow_forwardYou have sequenced the genome of the bacterium Salmonella typhimurium, and you are using BLAST analysis to identify similarities within the S. typhimurium genome to known proteins. You find a protein that is 100 percent identical in the bacterium Escherichia coli. When you compare nucleotide sequences of the S. typhimurium and E. coli genes, you find that their nucleotide sequences are only 87 percent identical.a. Explain this observation.b. What do these observations tell you about the merits of nucleotide- versus protein-similarity searches in identifying related genes?arrow_forwarda) Primers can sometimes bind and target the wrong gene, especially if the primers are allowed to bind to the DNA strands at a low temperature. PCR also preferentially amplify short segments of DNA. Would it be important to actually run the cDNA after the PCR on a DNA gel in order to check for a PCR product of the predicted size for the insulin gene? Why or why not?arrow_forward
- You are using the restriction enzyme HAEIII to digest different samples of the taster gene isolated from cheek cells of different people and amplified by PCR. When viewing the bands on the electrophoresis gel, one would expect that a taster (homozygote) would have---------band(s), whereas a carrier (heterozygote) would show--------band(s), and a non-taster would show------band(s).arrow_forwardYou are trying to clone a gene. You have successfully isolated it from the genomic DNA of an organism using the Hindlll restriction enzyme. You then take a plasmid with a single EcoRI restriction site and cleave it with EcoRI. You combine these two fragments and treat them with DNA ligase. Answer the two questions below. a.(2 points Does the cloning reaction succeed as described? If so, what is the product obtained? b. Explain your answer above.arrow_forwardThe exponential nature of PCR allows spectacular increases in the abundance of a DNA sequence being amplified. Consider a 10-kbp DNA sequence in a genome of 1010 base pairs. What fraction of the genome is represented by this sequence; i.e., what is the fractional abundance of this sequence in this genome? Calculate the fractional abundance of this target sequence after 10, 15, and 20 cycles of PCR, starting with DNA representing the whole genome and assuming that no other sequences in the genome undergo amplification in the process.arrow_forward
- From your knowledge about DNA microarray, answer the following: A- How DNA microarray is created? and why it is referred to as “hybridization technology”? B- Why RT-PCR is important in the sample preparation to perform expression microarray experiment? C- Mention the name and the color of the dyes used in expression microarray? D- If the expression microarray experiment was done with a normal sample and a suspected sample, after reading the color pattern resulted from the experiment it was recorded that “gene A22” is expressed in the suspected sample. The gene A22 is clinically linked to colon cancer. Answer the following: What is the expected color of the spot on the microarray which represents this gene? What is your interpretation of the suspected sample; is it a cancer sample or not and explain why?arrow_forwarda)Dr. Thisisaneasyexam decides to amplify a gene from a plasmid using PCR. She starts out with 6.6 x 10-14g of a 10 kb template in a 100 µl reaction. Assuming that the molecular weight of the average base pair is 660 Daltons calculate the number of molecules of the template. b)Given that the concentration of each primer (20 base pairs each) is 0.1µM in this same reaction volume (100 µl) calculate the number of molecules of the primer presentarrow_forwardYou are setting up your PCR reaction and accidentally add twice as much of the salt buffer as you were supposed to. Select all that apply. 1. How will this impact product formation? 2. In what way(s) will the reaction be altered? (a) ...because primer/template binding will be altered (b) ...because the mechanism of dNTP addition will be altered. (c) You will get more of the desired PCR product... (d) ...because template denaturation will be altered. (e) You will get the same amount of the desired PCR product... (f) You will get less of the desired PCR product...arrow_forward
- Referring to Figure 7-20, answer the following questions:a. What is the DNA polymerase I enzyme doing?b. What other proteins are required for the DNApolymerase III on the left to continue synthesizingDNA?c. What other proteins are required for the DNApolymerase III on the right to continue synthesizingDNA?arrow_forwardThe exponential nature of PCR allows spectacular increases in the abundanceof a DNA sequence being amplified. Consider a 10-kbp DNA sequence in agenome of 1010 base pairs. What fraction of the genome does this sequence represent? That is, what is the fractional abundance of this sequence in this genome?Calculate the fractional abundance of this target sequence after 10, 15, and 20 cycles of PCR, starting with DNA representing the whole genome and assuming that no other sequences in the genome undergo amplification in the process.arrow_forwardTranscriptome analysis involves two separate methodologies: gene expression and RNA seq analyses. The 10 items below are a scrambled listing of the steps used in the two procedures. Identify the steps involved in RNA seq from the list below. Use the numbers in the list to refer to each step. Once the steps for RNA seq have been identified, write the steps in the order in which they are performed during the experiment. (1) DNA sequencing (2) Allow for hybridization and wash excess cRNA. (3) Mix labeled cRNA with array chip. (4) PCR amplification (5) Measure fluorescence intensity to determine abundance of transcripts. (6) Add labeled cRNA at each microarray location. (7) Map cDNA sequences to the genome of the organism to determine identity and abundance of transcripts. (8) mRNA isolation from cells (9) Prepare fluorescently labeled cRNA probes (10) cDNA synthesisarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License