Genetics: From Genes to Genomes
6th Edition
ISBN: 9781259700903
Author: Leland Hartwell Dr., Michael L. Goldberg Professor Dr., Janice Fischer, Leroy Hood Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 11, Problem 38P
As explained in the text, the cause of many genetic diseases cannot yet be discerned by analyzing whole exome/genome sequences. But in some of these seemingly intractable cases, important clues can be obtained by looking at mRNAs or proteins, rather than at the DNA.
| a. As you will see in more detail in later chapters, it is possible to use single-molecule methods to sequence cDNA copies of millions of mRNA molecules from any particular tissue cheaply. How could you sometimes use such information to find a disease gene? When would this information be noninformative? |
| b. A technique called Western blotting allows you to examine any protein for which you have an antibody; it is possible to see differences in size or amount of that protein. How could you sometimes use such information to find a disease gene? When would this information be noninformative? |
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
After Drosophila DNA has been treated with a restriction enzyme, the fragments are inserted into plasmids and selected as clones in E. coli. With the use of this “shotgun” technique, every DNA sequence of Drosophila in a library can be recovered.a. How would you identify a clone that contains DNA encoding the protein actin, whose amino acid sequence is known?b. How would you identify a clone encoding a specific tRNA?
You would like to add a nuclear localization sequence (NLS) of Lys-Lys-Lys-Arg-Lys to a
protein that is usually found in the cytoplasm of a yeast cell. To accomplish this, you
introduce the nucleotide sequence encoding the NLS into the gene that encodes the
cytoplasmic protein of interest.
a. What is the size of the nucleotide insert that will encode the NLS? Briefly explain.
5'
3'
b. Below is a diagram of the gene encoding the cytoplasmic protein of interest in
the yeast genome. If your goal is to put the NLS at the carboxyl (C) terminus of
the protein, at which location (A-E) should the NLS be inserted? Briefly explain.
A
TATAA
ATATT
promoter
+1
B
ATG
TAC
D
TAA
ATT
stop
codon
E
3'
5'
Mutagenesis is a technique in which genetic information of an organism is altered in a stable
manner resulting in a mutation. It may occur spontaneously in nature of as a result of
exposure to mutagens. It can also be achieved experimentally using optimized laboratory
procedures.
(i)
(ii)
What is site directed mutagenesis (SDM)?
Explain how SDM can assist in the integration of a His-tag at the end of your gene of
interest.
Chapter 11 Solutions
Genetics: From Genes to Genomes
Ch. 11 - Choose the phrase from the right column that best...Ch. 11 - Would you characterize the pattern of inheritance...Ch. 11 - Would you be more likely to find single nucleotide...Ch. 11 - A recent estimate of the rate of base...Ch. 11 - If you examine Fig. 11.5 closely, you will note...Ch. 11 - Approximately 50 million SNPs have thus far been...Ch. 11 - Mutations at simple sequence repeat SSR loci occur...Ch. 11 - Humans and gorillas last shared a common ancestor...Ch. 11 - In 2015, an international team of scientists...Ch. 11 - Using PCR, you want to amplify an approximately 1...
Ch. 11 - Prob. 11PCh. 11 - The previous problem raises several interesting...Ch. 11 - You want to make a recombinant DNA in which a PCR...Ch. 11 - You sequence a PCR product amplified from a...Ch. 11 - Prob. 15PCh. 11 - The trinucleotide repeat region of the Huntington...Ch. 11 - Sperm samples were taken from two men just...Ch. 11 - Prob. 18PCh. 11 - a. It is possible to perform DNA fingerprinting...Ch. 11 - On July 17, 1918, Tsar Nicholas II; his wife the...Ch. 11 - The figure that follows shows DNA fingerprint...Ch. 11 - Microarrays were used to determine the genotypes...Ch. 11 - A partial sequence of the wild-type HbA allele is...Ch. 11 - a. In Fig. 11.17b, PCR is performed to amplify...Ch. 11 - The following figure shows a partial microarray...Ch. 11 - Scientists were surprised to discover recently...Ch. 11 - The microarray shown in Problem 25 analyzes...Ch. 11 - The figure that follows shows the pedigree of a...Ch. 11 - One of the difficulties faced by human geneticists...Ch. 11 - Now consider a mating between consanguineous...Ch. 11 - The pedigree shown in Fig. 11.22 was crucial to...Ch. 11 - You have identified a SNP marker that in one large...Ch. 11 - The pedigrees indicated here were obtained with...Ch. 11 - Approximately 3 of the population carries a mutant...Ch. 11 - The drug ivacaftor has recently been developed to...Ch. 11 - In the high-throughput DNA sequencing protocol...Ch. 11 - A researcher sequences the whole exome of a...Ch. 11 - As explained in the text, the cause of many...Ch. 11 - Figure 11.26 portrayed the analysis of Miller...Ch. 11 - A research paper published in the summer of 2012...Ch. 11 - Table 11.2 and Fig. 11.27 together portray the...Ch. 11 - The human RefSeq of the entire first exon of a...Ch. 11 - Mutations in the HPRT1 gene in humans result in at...Ch. 11 - Prob. 44P
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- In order to target a specific region of genomic DNA with CRISPR, researchers must include a guide RNA containing a 20-basepair long spacer sequence that matches the DNA sequence at the target site. (i) How many possible guide RNA spacer sequences are there? (ii) One of the possible risks of genetic engineering methods is “off-target” editing, where a modification of the genome occurs in a part of the genome other than the target site. Imagine you design a 20-basepair guide RNA spacer sequence to target a specific portion of the Zebrafish genome, which is 1.7 billion nucleotides long. Assuming all nucleotides are equally common, estimate the probability that your spacer sequence occurs in at least one other position in the Zebrafish genome.arrow_forwardWhich of the following set(s) of primers a-d could you use to amplify the following target DNA sequence, which is part of the last protein-coding exon of the CFTR gene? Explain briefly. (Note: The three dots represent the body of the region to be amplified, whose beginning and end are only being shown.) 5' GGCTAAGATCTGAATTTTCCGAG . TTGGGCAATAATGTAGCGCCTT 3' 3' CCGATTCTAGACTTAAAAGGCTC . AACCCGTTATTACATCGCGGAA 5' a. 5' GGAAAATTCAGATCTTAG 3'; 5' TGGGCAATAATGTAGCGC 3' b. 5' GCTAAGATCTGAATTTTC 3'; 3' ACCCGTTATTACATCGCG 5' c. 3' GATTCTAGACTTAAAGGC 5'; 3' АССCGTTATTАСАТСGCG 5 d. 5' GCTAAGATCTGAATTTTC 3'; 5' TGGGCAATAATGTAGCGC 3'arrow_forwardConsider a stretch of DNA (a hypothetical gene) that has the sequence 5’ ATG-CTA-TCA-TGG-TTC-TAA 3’ A) Transcribe and translate this gene using the genetic code table. Be sure to label the mRNA 3’ and 5’ ends. Write the amino acid sequence using 1 letter abbreviations. B) Now, our hypothetical gene has undergone a mutation. The mutant sequence is....3’ TAC-GAT-AGT-ACC-AAT-ATT 5’5’ ATG-CTA-TCA-TGG-TTA-TAA 3’ Transcribe and translate the mutant sequence. Be sure to label the mRNA 3’ and 5’ ends. Write the amino acid sequence using 1 letter abbreviations. C) Indicate the type of mutation (nonsense, missense, silent, or frame shift) present. D) How severe of a consequence will this mutation likely be in terms of protein function (none, mild, moderate or severe)? Why?arrow_forward
- a) Complete the table below. Assume that reading is from left to right and that the columns represent transcriptional and translational alignments. Label the 5’ and 3’ ends of DNA and RNA and carboxy and amino acid ends of protein. (You may fill in this chart by hand writing- no typing necessary here.) 2. b) Is the top or bottom DNA strand the template strand?arrow_forwardYou isolate a mouse Tau-gene-containing DNA fragment from the chicken and hybridize it to the freshly-made and isolated hnRNA (primary transcript) from the nucleus of the mouse cells transcribed from the Tau gene (immediately after it was produced), allowing no time for processing of the hnRNA. Describe what you see when you look at the DNA/RNA hybrid molecule under the electron microscope.arrow_forwardThe following figure shows a screen shot from the UCSC Genome Browser, focusing on a region of the human genome encoding a gene called MFAP3L. (Note hg38 refers to version 38 of the human genome RefSeq) a. Describe in approximate terms the genomic location of MFAP3L. b. Is the gene transcribed in the direction from the centromere-to-telomere or from the telomere-to-centromere? c. How many alternative splice forms of MFAP3L mRNA are indicated by the data? d. How many different promoters for MFAP3L are suggested by the data?arrow_forward
- The following figure shows a screen shot from the UCSC Genome Browser, focusing on a region of the human genome encoding a gene called MFAP3L. (Note hg38 refers to version 38 of the human genome RefSeq)a. Describe in approximate terms the genomic location of MFAP3L.b. Is the gene transcribed in the direction from the centromere-to-telomere or from the telomere-to-centromere?c. How many alternative splice forms of MFAP3L mRNA are indicated by the data?d. How many different promoters for MFAP3L are suggested by the data? (please do not copy and paste the answer from below. i don't think it is correct. a. MFAP3L is mostly found in the nucleus in the genome. It is found on chromosome 4 reverse strand. The protein produced by the gene is found in the cell membrane, and it is positioned on the membrane with the carboxyl side of the protein facing the cytosol. b. The MFAP3L gene is transcribed from the telomere to the centromere. c. According to the data, there are 11 different splice forms…arrow_forwardHuman genomic libraries used for DNA sequencing are often made from fragments obtained by cleaving human DNA with Haeiii in such a way that the DNA is only partially digested; that is, not all the possible HaeIII sites have been cleaved. What is a possible reason for doing this?arrow_forwardRefer to the DNA sequence provided: 3’ -TACTGAAGCGGCAGCCCCGCATGAGTAGACCTTACT-5’ a. What is the mRNA transcript of the anticoding strand of the DNA model? b. What is the amino acid sequence of the polypeptide chain that will be translated from the mRNA in (a)?arrow_forward
- As we focused on the genetic code and the transcription of genetic information stored in DNA into complementary RNA molecules. Along the way, we found many opportunities to consider the methods and reasoning by which much of this information was acquired. From the explanations given in the chapter, what answers would you propose to the following fundamental questions: Question: How do we know that the initial transcript of a eukaryotic gene contains noncoding sequences that must be removed before accurate translation into proteins can occur?arrow_forwardThe abundance of three mRNA transcripts, transcripts A, B, and C, was measured by real-time PCR. The average CT values were 14.6, 20.2, and 10.5 for transcripts A, B, and C, respectively. Determine the relative order of abundance of the transcripts. Name one technique that could be used to confirm that the order of abundance at the mRNA transcript level is reflected at the protein level.arrow_forwardRefer to the DNA sequence provided:3’ -TACTGAAGCGGCAGCCCCGCATGAGTAGACCTTACT-5’ b. What is the amino acid sequence of the polypeptide chain that will be translated from the mRNAin (a)? (The question for A is this: What is the mRNA transcript of the anticoding strand of the DNA model?)arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License