Genetics: Analysis and Principles
6th Edition
ISBN: 9781259616020
Author: Robert J. Brooker Professor Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 10, Problem 1EQ
Two circular DNA molecules, which we can call molecule A and molecule B, are topoisomers of each other. When viewed under the electron microscope, molecule A appears more compact than molecule B. The level of gene transcription is much lower for molecule A. Which of the following three possibilities could account for these observations?
First possibility: Molecule A has three positive supercoils, and molecule B has three negative supercoils.
Second possibility: Molecule A has four positive supercoils, and molecule B has one negative supercoil.
Third possibility: Molecule A has zero supercoils, and molecule B has three negative supercoils.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
A solution contains DNA polymerase and the Mg ²+ salts of dATP, dGTP, dCTP, and TTP. The following DNA molecules are added to aliquots of this solution. Which of them would lead to DNA synthesis? (a) A single-stranded closed circle containing 1000 nucleotide units. (b) A double-stranded closed circle containing 1000 nucleotide pairs. (c) A single-stranded closed circle of 1000 nucleotides base-paired to a linear strand of 500 nucleotides with a free 3' -OH terminus. (d) A double-stranded linear molecule of 1000 nucleotide pairs with a free 3’-OH group at each end.
Cystic fibrosis (CF) is an inherited disorder caused by different types of mutations, many of which prevent ions from moving across cell membranes. Normally there are channel proteins that allow passage of the ions, but in patients with one kind of CF these proteins seem odd. Closer examination shows that these proteins display the correct amino acid sequence. However, they fail to do their job. A) Given that the primary structure of the protein is correct, what can you infer about the DNA sequence for the gene coding this protein on this patient, is there a mutation? Explain. B) Why is the primary structure insufficient to guarantee the proper function of the protein?
Let’s suppose you have isolated chromatin from some bizarre eukaryote that has a DNA linker region that is usually 300 to 350 bp in length. The nucleosome structure is the same as in other eukaryotes. If you digested this eukaryotic organism’s chromatin with a high concentration of DNase I, what would be your expected results?
Chapter 10 Solutions
Genetics: Analysis and Principles
Ch. 10.1 - 1. A bacterial chromosome typically contains
a. a...Ch. 10.2 - Mechanisms that make the bacterial chromosome more...Ch. 10.2 - 2. Negative supercoiling may enhance activities...Ch. 10.2 - 3. DNA gyrase
a. promotes negative supercoiling....Ch. 10.3 - 1. The chromosomes of eukaryotes typically contain...Ch. 10.4 - Which of the following is an example of a...Ch. 10.5 - What are the components of a single nucleosome? a....Ch. 10.5 - 2. In Noll’s experiment to test the...Ch. 10.5 - Prob. 3COMQCh. 10.5 - Prob. 4COMQ
Ch. 10.6 - Prob. 1COMQCh. 10.6 - 2. The role of cohesin is to
a. make chromosomes...Ch. 10 - Prob. 1CONQCh. 10 - Prob. 2CONQCh. 10 - 3. Describe the mechanisms by which bacterial DNA...Ch. 10 - Why is DNA supercoiling called supercoiling rather...Ch. 10 - Prob. 5CONQCh. 10 - Prob. 6CONQCh. 10 - Prob. 7CONQCh. 10 - Prob. 8CONQCh. 10 - Prob. 9CONQCh. 10 - 10. What is the function of a centromere? At what...Ch. 10 - Prob. 11CONQCh. 10 - 12. Describe the structures of a nucleosome and a...Ch. 10 - Beginning with the G1 phase of the cell cycle,...Ch. 10 - Draw a picture depicting the binding between the...Ch. 10 - 15. Compare heterochromatin and euchromatin. What...Ch. 10 - 16. Compare the structure and cell localization of...Ch. 10 - 17. What types of genetic activities occur during...Ch. 10 - Lets assume the linker region of DNA averages 54bp...Ch. 10 - 19. In Figure 10.12, what are we looking at in...Ch. 10 - 20. What are the roles of the core histone...Ch. 10 - A typical eukaryotic chromosome found in humans...Ch. 10 - Which of the following terms should not be used to...Ch. 10 - Discuss the differences between the compaction...Ch. 10 - 24. What is an SMC complex? Describe two...Ch. 10 - Two circular DNA molecules, which we can call...Ch. 10 - 2. Let’s suppose you have isolated DNA from a cell...Ch. 10 - 3. We seem to know more about the structure of...Ch. 10 - In Nolls experiment of Figure 10.11, explain where...Ch. 10 - When chromatin is treated with a salt solution of...Ch. 10 - 6. Let’s suppose you have isolated chromatin from...Ch. 10 - If you were given a sample of chromosomal DNA and...Ch. 10 - Consider how histone proteins bind to DNA and then...Ch. 10 - In Chapter 23, the technique of fluorescence in...Ch. 10 - Bacterial and eukaryotic chromosomes are very...Ch. 10 - The prevalence of highly repetitive sequences...Ch. 10 - Discuss and make a list of the similarities and...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Supercoiled DNA is slightly unwound compared to relaxed DNA and this enables it to assume a more compact structure with enhanced physical stability. Describe the enzymes that control the number of supercoils present in the E. coli chromosome. How much would you have to reduce the linking number to increase the number of supercoils by five?arrow_forwarda) Complete the table below. Assume that reading is from left to right and that the columns represent transcriptional and translational alignments. Label the 5’ and 3’ ends of DNA and RNA and carboxy and amino acid ends of protein. (You may fill in this chart by hand writing- no typing necessary here.) 2. b) Is the top or bottom DNA strand the template strand?arrow_forwardA diploid human cell contains approximately 6.4 billion base pairs of DNA. Assuming that the linker DNA encompasses 35 bp, how many nucleosomes are present in such a cell? Use two significant figures. How many histone proteins are complexed with this DNA? use two significant figures.arrow_forward
- a) One DNA strand of Chromosome #12 has the following nucleotide sequence: TAC/CGC/CCT. What nitrogenous bases would be found on "the other DNA strand lying alongside of it?" b) Which nitrogenous bases would be found on the MRNA (Messenger RNA) transcribed from a DNA strand with the following nucleotide sequence: AAA/TTT/GGG/CCC?arrow_forwardAn article entitled “Nucleosome Positioning at the Replication Fork” states: “both the ‘old’ randomly segregated nucleosomes as well as the ‘new’ assembled histone octamers rapidly position themselves (within seconds) on the newly replicated DNA strands” [Lucchini et al. (2002)]. Given this statement, how would one compare the distribution of nucleosomes and DNA in newly replicated chromatin? How could one experimentally test the distribution of nucleosomes on newly replicated chromosomes?arrow_forwardIn the following sequence, a cytosine was deaminated and is now a uracil (underlined). 5’-GGTAUTAAGC-3’ a. Which repair pathway(s) could restore this uracil to cytosine? b. If the uracil is not removed before a DNA replication fork passes through, what will be the sequences of the two resulting double helices? Provide the sequences of both strands of both helices. Label the old and new strands and underline the mutation(s). c. Could the mismatch repair pathway fix the mutations you’ve indicated in part b? d. If the cell undergoes mitosis, and the replicated DNAs are distributed into the two daughter cells. Will 0, 1, or 2 daughter cells have a mutation in this sequence?arrow_forward
- As you should recall, DNA, when not being actively transcribed, has a double helical structure. This portion of the DNA has had the two strands separated in preparation of transcribing for a needed protein. The following is one of the two complimentary strands of DNA: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5' Q: Based on written convention, i.e. the 3'-5' orientation, is this the coding strand or the template strand? ______________________________ Q: Assuming this strand extends from base #1 to #61 (going left to right), interpret the correctly transcribed mRNA and translated polypeptide for bases 24 - 47: mRNA: ___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___- polypeptide chain: ________--________--________--________--________--________--________--________arrow_forwardConsider the following segment of DNA, which is part of a linear chromosome: LEFT 5’.…TGACTGACAGTC….3’ 3’.…ACTGACTGTCAG….5’ RIGHT During RNA transcription, this double-strand molecule is separated into two single strands from the right to the left and the RNA polymerase is also moving from the right to the left of the segment. Please select all the peptide sequence(s) that could be produced from the mRNA transcribed from this segment of DNA. (Hint: you need to use the genetic codon table to translate the determined mRNA sequence into peptide. Please be reminded that there are more than one reading frames.) Question 6 options: ...-Asp-Cys-Gln-Ser-... ...-Leu-Thr-Val-... ...-Thr-Val-Ser-... ...-Leu-Ser-Val-... ...-Met-Asp-Cys-Gln-...arrow_forwardConsider the following segment of DNA, which is part of a linear chromosome: LEFT 5’.…TGACTGACAGTC….3’ 3’.…ACTGACTGTCAG….5’ RIGHT During RNA transcription, this double-strand DNA molecule is separated into two single strands from the right to the left and the RNA polymerase is also moving from the right to the left of the segment. _____________ is the template strand for the synthesis of RNA? The sequence of the newly transcribed mRNA is _________________. Question 5 options: The top strand, 5'...GACUGUCAGUCA...3' The bottom strand, 5'...ACUCACUCUCAG...3' The top strand, 5'...UGACUGACAGUC...3' The bottom strand, 5'...GACUGUCAGUCA...3'arrow_forward
- several options can be correct Consider the following segment of DNA, which is part of a linear chromosome: LEFT 5’.…TGACTGACAGTC….3’ 3’.…ACTGACTGTCAG….5’ RIGHT During RNA transcription, this double-strand molecule is separated into two single strands from the right to the left and the RNA polymerase is also moving from the right to the left of the segment. Please select all the peptide sequence(s) that could be produced from the mRNA transcribed from this segment of DNA. (Hint: you need to use the genetic codon table to translate the determined mRNA sequence into peptide. Please be reminded that there are more than one reading frames.) Question 6 options: ...-Asp-Cys-Gln-Ser-... ...-Leu-Thr-Val-... ...-Thr-Val-Ser-... ...-Leu-Ser-Val-... ...-Met-Asp-Cys-Gln-...arrow_forwardAs shown, five DnaA boxes are found within the origin of replication in E. coli. Take a look at these five sequences carefully. A. Are the sequences of the five DnaA boxes very similar to each other? (Hint: Remember that DNA is double-stranded; think about these sequences in the forward and reverse directions.) B. What is the most common sequence for a DnaA box? In other words, what is the most common base in the first position, second position, and so on until the ninth position? The most common sequence is called the consensus sequence. C. The E. coli chromosome is about 4.6 million bp long. Based on random chance, is it likely that the consensus sequence for a DnaA box occurs elsewhere in the E. coli chromosome? If so, why aren’t there multiple origins of replication in E. coli?arrow_forwardA deamination occurs on the cytosine residue in the following DNA sequence. This cytosine residue happens to be methylated on the 5-position of the aromatic ring. 5'-GCATGG-3'. (Note: the top strand is shown; this is the strand where the deamination occurs.) If the mutation is not repaired, and a round of DNA replication occurs, then the sequence of the newly- replicated complementary strand (i.e., the bottom strand) will be: A. 5'-CCATGC-3 B. 5'-CCATAC-3' C. 5'-CATACC-3' D. 5'-GTATGG-3' E. None of the abovearrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY