Genetics: Analysis and Principles
6th Edition
ISBN: 9781259616020
Author: Robert J. Brooker Professor Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 10, Problem 18CONQ
Let’s assume the linker region of DNA averages
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Let’s assume the linker region of DNA averages 54 bp in length. How many molecules of H2A would you expect to find in a DNA sample that is 46,000 bp in length?
The DNA chromosome in E. coli contains approximately 4 million base pairs. The average gene contains about 1500 base pairs. Use this information to calculate the following (show all work ):
a) The length in meters of this chromosome.
b) The approximate number of genes in the chromosome (assuming no wasted DNA).
For a linear B-DNA molecule of 50,000 kb, calculate (a) the contour length and (b) the length of the DNA as packaged in nucleosomes with linker histones present.
Chapter 10 Solutions
Genetics: Analysis and Principles
Ch. 10.1 - 1. A bacterial chromosome typically contains
a. a...Ch. 10.2 - Mechanisms that make the bacterial chromosome more...Ch. 10.2 - 2. Negative supercoiling may enhance activities...Ch. 10.2 - 3. DNA gyrase
a. promotes negative supercoiling....Ch. 10.3 - 1. The chromosomes of eukaryotes typically contain...Ch. 10.4 - Which of the following is an example of a...Ch. 10.5 - What are the components of a single nucleosome? a....Ch. 10.5 - 2. In Noll’s experiment to test the...Ch. 10.5 - Prob. 3COMQCh. 10.5 - Prob. 4COMQ
Ch. 10.6 - Prob. 1COMQCh. 10.6 - 2. The role of cohesin is to
a. make chromosomes...Ch. 10 - Prob. 1CONQCh. 10 - Prob. 2CONQCh. 10 - 3. Describe the mechanisms by which bacterial DNA...Ch. 10 - Why is DNA supercoiling called supercoiling rather...Ch. 10 - Prob. 5CONQCh. 10 - Prob. 6CONQCh. 10 - Prob. 7CONQCh. 10 - Prob. 8CONQCh. 10 - Prob. 9CONQCh. 10 - 10. What is the function of a centromere? At what...Ch. 10 - Prob. 11CONQCh. 10 - 12. Describe the structures of a nucleosome and a...Ch. 10 - Beginning with the G1 phase of the cell cycle,...Ch. 10 - Draw a picture depicting the binding between the...Ch. 10 - 15. Compare heterochromatin and euchromatin. What...Ch. 10 - 16. Compare the structure and cell localization of...Ch. 10 - 17. What types of genetic activities occur during...Ch. 10 - Lets assume the linker region of DNA averages 54bp...Ch. 10 - 19. In Figure 10.12, what are we looking at in...Ch. 10 - 20. What are the roles of the core histone...Ch. 10 - A typical eukaryotic chromosome found in humans...Ch. 10 - Which of the following terms should not be used to...Ch. 10 - Discuss the differences between the compaction...Ch. 10 - 24. What is an SMC complex? Describe two...Ch. 10 - Two circular DNA molecules, which we can call...Ch. 10 - 2. Let’s suppose you have isolated DNA from a cell...Ch. 10 - 3. We seem to know more about the structure of...Ch. 10 - In Nolls experiment of Figure 10.11, explain where...Ch. 10 - When chromatin is treated with a salt solution of...Ch. 10 - 6. Let’s suppose you have isolated chromatin from...Ch. 10 - If you were given a sample of chromosomal DNA and...Ch. 10 - Consider how histone proteins bind to DNA and then...Ch. 10 - In Chapter 23, the technique of fluorescence in...Ch. 10 - Bacterial and eukaryotic chromosomes are very...Ch. 10 - The prevalence of highly repetitive sequences...Ch. 10 - Discuss and make a list of the similarities and...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- How many kilobases of the DNA strand below will code for the protein product?arrow_forwardA duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has a melting temperature (tm) of 59 °C. If an RNA duplex oligonucleotide of identical sequence (substituting U for T) isconstructed, will its melting temperature be higher or lower?arrow_forwardA compact disc (CD) stores about 4.8 × 109 bits of information in a 96 cm2 area. This information is stored as a binary code—that is, every bit is either a 0 or a 1. how many bits would it take to specify each nucleotide pair in a DNA sequence? how many CDs would it take to store the information contained in the human genome?arrow_forward
- One gram of cultured human cells contains about 109 cells and occupies roughly 1 mL. If the average molecular mass of a base pair is 660 daltons and each cell contains 6.4 x 109 bp, what mass of DNA is present in this one-gram sample? If all the DNA molecules in the sample were laid end to end to form a single thread, would it be long enough to reach from the Earth to the Moon (385,000 kilometers)?arrow_forwardThe sequences of several short single-stranded DNA molecules are shown below. Imagine each sequence as a typical double-stranded DNA molecule, with antiparallel strands held together by Watson-Crick base- pairs between the complementary bases. Which of these double-stranded molecules would have the highest melting temperature (Tm)? 5' ACTGAGTCTCTGACTAGTCT 3' 5' ACTTAGTCTATGACTAGTCT 3' 5' ACTTAATCTATGAATAGTCT 3' 5' ACTGCGTCTCCGACTAGTCT 3' 5' ACTGCGTCTCCGACGAGCCT 3'arrow_forwardA duplex DNA molecule contains a random sequence of the four nucleotides with equal proportions of each. What is the average spacing between consecutive occurrences of the sequence 5'-ATGC-3'? Between consecutive occurrences of the sequence 5'-TACGGC-3'?arrow_forward
- The Tm of a DNA strand can be calculated by hand using the formula: (2 ℃)(?????? ?? ? + ?) + (4 ℃)(?????? ?? ? + ?) = ??℃ Using this formular, calculate the Tm for the following DNA sequence: [CTTTCACAGCCACTATCCAGCGGTAC] Note: This formula has several limitations and is not useful for sequences longer than 14 bp. Use the Internet search to find an online Tm calculator. Use this calculator to find the Tm of the above sequence. Using information from your search, identify three factors that can affect the Tm.arrow_forwardThe Bacteria Escherichia coli DNA genome has a molecular mass of about 3.1 X 10° D. In your answers, show how you came up to each result? (a) How many base pairs does this bacterium contain? (b) How many full double-helical turns does this DNA contain? (c) How long is this DNA in um?arrow_forwardA solution contains DNA polymerase and the Mg ²+ salts of dATP, dGTP, dCTP, and TTP. The following DNA molecules are added to aliquots of this solution. Which of them would lead to DNA synthesis? (a) A single-stranded closed circle containing 1000 nucleotide units. (b) A double-stranded closed circle containing 1000 nucleotide pairs. (c) A single-stranded closed circle of 1000 nucleotides base-paired to a linear strand of 500 nucleotides with a free 3' -OH terminus. (d) A double-stranded linear molecule of 1000 nucleotide pairs with a free 3’-OH group at each end.arrow_forward
- A diploid human cell contains approximately 6.4 billion base pairs of DNA. Assuming that the linker DNA encompasses 35 bp, how many nucleosomes are present in such a cell? Use two significant figures. How many histone proteins are complexed with this DNA? use two significant figures.arrow_forwardIf you analyze a double-stranded DNA molecule and find that 15% of all the nucleotide bases are Adenines, you know that there must also be [ Select ] Thymines, [ Select ] Guanines, [ Select ] v Cytosines and [ Select ] Uracils. (Count each of the bases in any double stranded DNA molecule and calculate their percentages to find the simple key for this if you haven't seen it yet.)arrow_forwardWhich of the following DNAs is most likely to contain the recognition sequence for a homodimeric DNA binding protein? (Note that only one strand of the DNA is shown - you will find it helpful to write down the sequence and the sequence of the opposite strand to answer this question.) a) 5’- G A G C G A T C G C T C - 3’ b) 5’- G A G C G A G A G C G A - 3’ c) 5’- G A G C G A A G C G A G - 3’arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Genome Annotation, Sequence Conventions and Reading Frames; Author: Loren Launen;https://www.youtube.com/watch?v=MWvYgGyqVys;License: Standard Youtube License