Genetics: Analysis and Principles
6th Edition
ISBN: 9781259616020
Author: Robert J. Brooker Professor Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 10, Problem 6EQ
Let’s suppose you have isolated chromatin from some bizarre eukaryote with a linker region that is usually
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Let’s suppose you have isolated chromatin from some bizarreeukaryote with a linker region that is usually 300–350 bp inlength. The nucleosome structure is the same as in other eukaryotes.If you digested this eukaryotic organism’s chromatin with ahigh concentration of DNase I, what would be your expectedresults?
A diploid human cell contains approximately 6.4 billion base pairs of DNA.
Assuming that the linker DNA encompasses 35 bp, how many nucleosomes are present in such a cell? Use two significant figures. How many histone proteins are complexed with this DNA? use two significant figures.
Forming nucleosomes and wrapping them into a 30-nm fiber provide part of the compaction of DNA in chromatin. If the fiber contains about six nucleosomes per 10 nm of length, what is the approximate compaction ratio achieved?
Chapter 10 Solutions
Genetics: Analysis and Principles
Ch. 10.1 - 1. A bacterial chromosome typically contains
a. a...Ch. 10.2 - Mechanisms that make the bacterial chromosome more...Ch. 10.2 - 2. Negative supercoiling may enhance activities...Ch. 10.2 - 3. DNA gyrase
a. promotes negative supercoiling....Ch. 10.3 - 1. The chromosomes of eukaryotes typically contain...Ch. 10.4 - Which of the following is an example of a...Ch. 10.5 - What are the components of a single nucleosome? a....Ch. 10.5 - 2. In Noll’s experiment to test the...Ch. 10.5 - Prob. 3COMQCh. 10.5 - Prob. 4COMQ
Ch. 10.6 - Prob. 1COMQCh. 10.6 - 2. The role of cohesin is to
a. make chromosomes...Ch. 10 - Prob. 1CONQCh. 10 - Prob. 2CONQCh. 10 - 3. Describe the mechanisms by which bacterial DNA...Ch. 10 - Why is DNA supercoiling called supercoiling rather...Ch. 10 - Prob. 5CONQCh. 10 - Prob. 6CONQCh. 10 - Prob. 7CONQCh. 10 - Prob. 8CONQCh. 10 - Prob. 9CONQCh. 10 - 10. What is the function of a centromere? At what...Ch. 10 - Prob. 11CONQCh. 10 - 12. Describe the structures of a nucleosome and a...Ch. 10 - Beginning with the G1 phase of the cell cycle,...Ch. 10 - Draw a picture depicting the binding between the...Ch. 10 - 15. Compare heterochromatin and euchromatin. What...Ch. 10 - 16. Compare the structure and cell localization of...Ch. 10 - 17. What types of genetic activities occur during...Ch. 10 - Lets assume the linker region of DNA averages 54bp...Ch. 10 - 19. In Figure 10.12, what are we looking at in...Ch. 10 - 20. What are the roles of the core histone...Ch. 10 - A typical eukaryotic chromosome found in humans...Ch. 10 - Which of the following terms should not be used to...Ch. 10 - Discuss the differences between the compaction...Ch. 10 - 24. What is an SMC complex? Describe two...Ch. 10 - Two circular DNA molecules, which we can call...Ch. 10 - 2. Let’s suppose you have isolated DNA from a cell...Ch. 10 - 3. We seem to know more about the structure of...Ch. 10 - In Nolls experiment of Figure 10.11, explain where...Ch. 10 - When chromatin is treated with a salt solution of...Ch. 10 - 6. Let’s suppose you have isolated chromatin from...Ch. 10 - If you were given a sample of chromosomal DNA and...Ch. 10 - Consider how histone proteins bind to DNA and then...Ch. 10 - In Chapter 23, the technique of fluorescence in...Ch. 10 - Bacterial and eukaryotic chromosomes are very...Ch. 10 - The prevalence of highly repetitive sequences...Ch. 10 - Discuss and make a list of the similarities and...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Unlike bacterial cells, the nucleus of a eukaryotic cell is bounded by a double-layered membrane studded by complex pores. How do you think this might affect traffic between the DNA and cytoplasm of a eukaryotic cell compared to that of a prokaryotic cell?arrow_forwardAs you should recall, DNA, when not being actively transcribed, has a double helical structure. This portion of the DNA has had the two strands separated in preparation of transcribing for a needed protein. The following is one of the two complimentary strands of DNA: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5' Q: Based on written convention, i.e. the 3'-5' orientation, is this the coding strand or the template strand? ______________________________ Q: Assuming this strand extends from base #1 to #61 (going left to right), interpret the correctly transcribed mRNA and translated polypeptide for bases 24 - 47: mRNA: ___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___- polypeptide chain: ________--________--________--________--________--________--________--________arrow_forwardWhat is the difference between heterochromatin and euchromatin? What accounts for (or causes) the difference?arrow_forward
- An article entitled “Nucleosome Positioning at the Replication Fork” states: “both the ‘old’ randomly segregated nucleosomes as well as the ‘new’ assembled histone octamers rapidly position themselves (within seconds) on the newly replicated DNA strands” [Lucchini et al. (2002)]. Given this statement, how would one compare the distribution of nucleosomes and DNA in newly replicated chromatin? How could one experimentally test the distribution of nucleosomes on newly replicated chromosomes?arrow_forwardWe seem to know more about the structure of eukaryotic chromosomal DNA than bacterial DNA. Discuss why you think this is so,and list several experimental procedures that have yielded important information concerning the compaction of eukaryoticchromatinarrow_forwardHeterochromatin has a less compact structure, whereas euchromatin is more compact and composed of an array of nucleosomes condensed into a fiber true or false?arrow_forward
- If the DNA of chromosome 1 is fully extended, it will exceed the diameter of the nucleus of a cell by about 15,000 times. Therefore, discuss how DNA is packaged into the cell.arrow_forwardOne of the following is a characteristic of eukaryotic genetic material? 1. Eukaryotic genetic material is compacted by wrapping the double-helix around histone proteins to form nucleosomes. 2. Eukaryotic genetic material consists of supercoiled circular DNA molecules complexed with proteins into chromosomes. 3. Eukaryotic genetic material consists of relaxed linear DNA molecules complexed with RNA into a 30 nm fiber. 4. Eukaryotic genetic material is compacted by folding linker regions around non-histone proteins to form a scaffold.arrow_forwardA major difference between prokaryotes and eukaryotes is the presence of a nucleus. What advantages and disadvantages may occur with having a cell’s genome packaged in a nucleus?arrow_forward
- What is the difference between euchromatin and heterochromatin?arrow_forwardAssuming that the 30-nm chromatin fiber con-tains about 20 nucleosomes (200 bp/nucleosome) per 50nm of length, calculate the degree of compaction of DNAassociated with this level of chromatin structure. Whatfraction of the 10,000-fold condensation that occurs atmitosis does this level of DNA packing represent?arrow_forwardYou are interested in studying a gene called pumper that is important for heart function. The pumper gene is only expressed (transcribed) in heart cells, and you think the reason for this may have to do with chromatin structure. To investigate this, you isolate chromatin from heart cells and skin cells, and perform a long digestion of both samples with DNAse I, a non-sequence specific enzyme that will cut the phosphodiester bonds linking adjacent nucleotides. You then remove all proteins and analyze the DNA by gel-electrophoresis. You are able to detect only the DNA fragments that contain the pumper gene. The bands at the top of lane 2 indicate very large DNA fragments that were not able to migrate very far in the gel. The numbers to the left indicate where in the gel DNA fragments of the indicated size would migrate. Based on this data, which of the following is likely to be TRUE regarding the pumper locus in heart cells? (select all that apply) hyper-acetylation of lysine on Histone…arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Biology - Intro to Cell Structure - Quick Review!; Author: The Organic Chemistry Tutor;https://www.youtube.com/watch?v=vwAJ8ByQH2U;License: Standard youtube license