Genetics: Analysis and Principles
6th Edition
ISBN: 9781259616020
Author: Robert J. Brooker Professor Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Textbook Question
Chapter 10, Problem 4CONQ
Why is DNA supercoiling called supercoiling rather than just coiling? Why is positive supercoiling called overwinding and negative supercoiling called underwinding? How would you define the terms positive and negative supercoiling for Z DNA (described in Chapter 9)?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
What is meant by the term semiconservativereplication? What are the functions of DNA Pol I and III,helicase, and primase? How does a leading strand differfrom a lagging strand?
in the DNA of certain bacterial cells, 13% of the nucleotides are adenine. What are the percentages of the other nucleotides?
n an inversion, is a 5′ DNA end ever joined to another 5′ end? Explain.
Chapter 10 Solutions
Genetics: Analysis and Principles
Ch. 10.1 - 1. A bacterial chromosome typically contains
a. a...Ch. 10.2 - Mechanisms that make the bacterial chromosome more...Ch. 10.2 - 2. Negative supercoiling may enhance activities...Ch. 10.2 - 3. DNA gyrase
a. promotes negative supercoiling....Ch. 10.3 - 1. The chromosomes of eukaryotes typically contain...Ch. 10.4 - Which of the following is an example of a...Ch. 10.5 - What are the components of a single nucleosome? a....Ch. 10.5 - 2. In Noll’s experiment to test the...Ch. 10.5 - Prob. 3COMQCh. 10.5 - Prob. 4COMQ
Ch. 10.6 - Prob. 1COMQCh. 10.6 - 2. The role of cohesin is to
a. make chromosomes...Ch. 10 - Prob. 1CONQCh. 10 - Prob. 2CONQCh. 10 - 3. Describe the mechanisms by which bacterial DNA...Ch. 10 - Why is DNA supercoiling called supercoiling rather...Ch. 10 - Prob. 5CONQCh. 10 - Prob. 6CONQCh. 10 - Prob. 7CONQCh. 10 - Prob. 8CONQCh. 10 - Prob. 9CONQCh. 10 - 10. What is the function of a centromere? At what...Ch. 10 - Prob. 11CONQCh. 10 - 12. Describe the structures of a nucleosome and a...Ch. 10 - Beginning with the G1 phase of the cell cycle,...Ch. 10 - Draw a picture depicting the binding between the...Ch. 10 - 15. Compare heterochromatin and euchromatin. What...Ch. 10 - 16. Compare the structure and cell localization of...Ch. 10 - 17. What types of genetic activities occur during...Ch. 10 - Lets assume the linker region of DNA averages 54bp...Ch. 10 - 19. In Figure 10.12, what are we looking at in...Ch. 10 - 20. What are the roles of the core histone...Ch. 10 - A typical eukaryotic chromosome found in humans...Ch. 10 - Which of the following terms should not be used to...Ch. 10 - Discuss the differences between the compaction...Ch. 10 - 24. What is an SMC complex? Describe two...Ch. 10 - Two circular DNA molecules, which we can call...Ch. 10 - 2. Let’s suppose you have isolated DNA from a cell...Ch. 10 - 3. We seem to know more about the structure of...Ch. 10 - In Nolls experiment of Figure 10.11, explain where...Ch. 10 - When chromatin is treated with a salt solution of...Ch. 10 - 6. Let’s suppose you have isolated chromatin from...Ch. 10 - If you were given a sample of chromosomal DNA and...Ch. 10 - Consider how histone proteins bind to DNA and then...Ch. 10 - In Chapter 23, the technique of fluorescence in...Ch. 10 - Bacterial and eukaryotic chromosomes are very...Ch. 10 - The prevalence of highly repetitive sequences...Ch. 10 - Discuss and make a list of the similarities and...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- In the Meselson-Stahl experiment on DNA replication, what fraction of the DNA was composed of one light strand and one heavy strand ("hybrid") after one generation of growth in medium containing 14N? After two generations of growth in a medium containing 14N? What fraction of hybrid DNA is expected after n generations of growth in a medium containing 14N?arrow_forwardSupercoiled DNA is slightly unwound compared to relaxed DNA and this enables it to assume a more compact structure with enhanced physical stability. Describe the enzymes that control the number of supercoils present in the E. coli chromosome. How much would you have to reduce the linking number to increase the number of supercoils by five?arrow_forwardWhy single strand DNA more dense than double stand?arrow_forward
- How many adenine bases are there if there are eight thousand cytosine bases in a fifteen thousand bp DNA?arrow_forwardIn some organisms, UV-induced thymine dimers can be repaired by photoreactivation, in which energy from visible light is used to split the bonds forming the cyclobutane ring ? true or false Non-homologous end joining occurs when enzymes cut out a few nucleotides around a double strand DNA break, and then fuse the ends back together (right) true or false?arrow_forwardA molecular biologist is investigating homologous recombination. One aim of this study is to reconstitute stages of the process in vitro. (a) Draw diagrams to show how the four synthetic oligonucleotides below could base-pair to form a stable model Holliday junction. W 5’ GATCGCATTGTAGCCGTAGGTCCACTGTAA 3’ X 5’ GTCCCATACGTAGCCGTAGGACATGTACCG 3’ Y 5’ CGGTACATGTCCTACGGCTACAATGCGATC 3’ Z 5’ TTACAGTGGACCTACGGCTACGTATGGGAC 3’ (b) What is branch migration? (c) What is the name of the enzyme that resolves a Holliday junction into two separate DNA duplexes? (d) On your diagram, indicate how the Holliday junction can be resolved in two different ways and draw the structures of the products.arrow_forward
- In Figure , what do the red and blue parts of the DNA labeled by balloon 6 represent?arrow_forwardWhat is the base sequence, specified in the 5′-to-3′ direction, for a segment of newly formed DNA if it was formed using the following template DNA segments? 3′ AATGC 5′ 5′ AATGC 3′ 3′ GCAGC 5′ 5′ GCAGC 3′arrow_forwardIn the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotides in the amino-acid-coding region is represented by the sequence: 3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand? 4B. If the DNA duplex for the beta chain of haemoglobin above were transcribed from left to right, deduce the base sequence of the RNA in this coding region.arrow_forward
- In the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotides in the amino-acid-coding region is represented by the sequence: 3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand? 4B. If the DNA duplex for the beta chain of haemoglobin above were transcribed from left to right, deduce the base sequence of the RNA in this coding region. 4C. In NOT more than 200 words, explain how eukaryotic RNA synthesized by RNA polymerase II is modified before leaving the nucleus?arrow_forwardA duplex DNA molecule contains a random sequence of the four nucleotides with equal proportions of each. What is the average spacing between consecutive occurrences of the sequence 5'-ATGC-3'? Between consecutive occurrences of the sequence 5'-TACGGC-3'?arrow_forwardWhat similarities and differences exist in the enzymatic activities of DNA polymerases I and III? What is the function of each DNA polymerase in bacterial cells?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
DNA Use In Forensic Science; Author: DeBacco University;https://www.youtube.com/watch?v=2YIG3lUP-74;License: Standard YouTube License, CC-BY
Analysing forensic evidence | The Laboratory; Author: Wellcome Collection;https://www.youtube.com/watch?v=68Y-OamcTJ8;License: Standard YouTube License, CC-BY