A deamination occurs on the cytosine residue in the following DNA sequence. This cytosine residue happens to be methylated on the 5-position of the aromatic ring. 5'-GCATGG-3'. (Note: the top strand is shown; this is the strand where the deamination occurs.) If the mutation is not repaired, and a round of DNA replication occurs, then the sequence of the newly- replicated complementary strand (i.e., the bottom strand) will be: A. 5'-CCATGC-3 B. 5'-CCATAC-3' C. 5'-CATACC-3' D. 5'-GTATGG-3' E. None of the above

What is the conformation of the glycosidic bond (i.e. orientation of the nucleobase relative to the the sugar) in the B-form of DNA?     syn     anti     alpha     hetero

Hydrolysis of the N-glycosyl bond between deoxyribose and a purine base in DNA creates an apurinic (AP) site. An AP site is more thermodynamically destabilizing to a DNA molecule than is a mismatched base pair. Examine the structure of an AP site. H₂N HN N O™ -O-P-O-CH₂ Guanine H₂N N HN Select the chemical consequences that could contribute to DNA instability at AP sites. H H 1₂0/ H fewer hydrogen bonds between the unpaired pyrimidine base and water disruption of the base-stacking interactions decreased interaction between the mutated DNA strand and histones increased ability of the deoxyribose ring to open without the attachment of the purine base H H Guanosine residue (in DNA) O™ -O-P-O-CH₂ O H H H O Apurinic residue H OH H

The following DNA sequence is found on a chromosome in rice plants:               5’ ACCTTGCTCACATGTGGCGTACCTTTCCGTCTATCTGAACAC 3’ What is the amino acid sequence of the longest protein that could be made from this stretch of DNA, assuming that this strand of DNA is the non-template strand?  (Remember that the start of translation requires the sequence AUG in the mRNA and “STOP” is not an amino acid.)

All guanines in the top strand of the following sequence are converted from the 'keto' tautomer to the 'enol' tautomer, resulting in pairing with thymine. (top strand) 5' TAGCATGCAA 3' (bottom strand) After a few rounds of replication, what will the sequence of the mutated top strand be? (5' to 3') (Newly incorporated nucleotides are in the 'keto' form.) 3' ATCGTACGTT 5'

A DNA fragment with the following base sequence has some cytosine bases that are methylated (indicated by C*) and others that are unmethylated. To determine the locations of methylated and unmethylated cytosines, researchers sequenced this fragment both with and without treatment with sodium bisulfite. Give the sequence of bases that will be read with and without bisulfite treatment. —ATCGC*GTTAC*GTTGC*GTCA—

If a given double stranded DNA undergoes enzymatic hydrolysis targeting only the "a" side in the phosphodiester bond, what are the consequent nucleotide products of the hydrolysis of the 2 strands? (Please write the answers using only the letters corresponding to the bases with either the p or OH beside it to indicate the phosphate and OH groups respectively.) Sequence in one strand: TCGATCAG Use the editor to format your answer

As you should recall, DNA, when not being actively transcribed, has a double helical structure.  This portion of the DNA has had the two strands separated in preparation of transcribing for a needed protein.  The following is one of the two complimentary strands of DNA: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5'    Q:  Based on written convention, i.e. the 3'-5' orientation, is this the coding strand or the template   strand?  ______________________________ Q:  Assuming this strand extends from base #1 to #61 (going left to right), interpret the correctly transcribed mRNA and translated polypeptide for bases 24 - 47: mRNA:      ___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___- polypeptide chain:  ________--________--________--________--________--________--________--________

Insulin is synthesized as preproinsulin, which has 81 amino acids. How many heterocyclic bases must be present in the informational DNA strand to code for preproinsulin (assuming no introns are present)?

What is/are the attributes that make nucleotide excision repair (NER) and base excision repair (BER) similar and/or different from each other? Select the correct response: The NER pathway is the only one that can remove DNA lesions in the strand regardless of their size which is followed by attaching the correct strand, then sealed by a DNA ligase. They both use the enzyme DNA glycosylases that recognizes the damaged DNA segments and proceed with repairing the faulty base in the strand. They differ NER only repairs purine bases while BER repairs pyrimidine bases. They both remove the damaged parts of the DNA where the BER pathway corrects only the identified damaged bases which are usually non-bulky lesions. The NER pathway, on the other hand, repairs the damage by removal of bulky DNA adducts which is a short-single stranded DNA segment. They both utilize the enzyme photolyase to reverse the damages created by the faulty section of the DNA. They both remove the damaged parts of the…