WHAT IF? The researchers needed further evidence, so they injectedbicoid mRNA into the anterior end of an egg from a female with a mutationdisabling the bicoid gene. Given that the hypothesis was supported, whatmust their results have been?

WHAT IF? The researchers needed further evidence, so they injectedbicoid mRNA into the anterior end of an egg from a female with a mutationdisabling the bicoid gene. Given that the hypothesis was supported, whatmust their results have been?

Name: WHAT IF? The researchers needed further evidence, so they injectedbico
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: WHAT IF? The researchers needed further evidence, so they injectedbicoid mRNA into the anterior end of an egg from a female with a mutationdisabling the bicoid gene. Given that the hypothesis was supported, whatmust their results have been?

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 17TYK

See similar textbooks

Similar questions

WHAT IF? DRAW IT The template strand of a geneincludes this sequence:3¿-TACTTGTCCGATATC-5¿. It is mutated to3¿-TACTTGTCCAATATC-5¿. For both wild-type and mutantsequences, draw the double-stranded DNA, the resultingmRNA, and the amino acid sequence each encodes. Whatis the effect of the mutation on the amino acid sequence?
GTTTTCACTGGCGAGCGTCATCTTCCTACT 7. Are there homologs for the identified gene in other systems? Identify one homolog in an invertebrate system (if there is none, provide a vertebratehomolog). 10. Generate a secondary structure prediction for one identified protein.
5. This diagram illustrates regulation of the Pitx-1 gene, which is expressed in various cell types • during certain stages of animal embryonic development. Answer the questions that follow: Promoter Coding Region Pelvis Olfactory Jaw Regulatory Segments ("Switches") a. Which portion of this sequence gets transcribed and translated into a protein? b. Which portion of this sequence underwent a deletion mutation in certain species of freshwater stickleback fish? Did that mutation have an impact on the amino acid sequence of the protein, when it was expressed? С. d. If this switch underwent the same mutation in a turtle embryo, how would the turtle's phenotype be impacted? е. Would this phenotypic change in the turtle likely be adaptive? Briefly explain.
. Let’s say that you have incredible skill and can isolate the white and red patches of tissue from the Drosophila eyes shown in Figure 12-24 in order to isolate mRNA from each tissue preparation. Using your knowledge of DNA techniques from Chapter 10, design an experiment that would allow you to determine whether RNA is transcribed from the white gene in the red tissue or the whitetissue or both. If you need it, you have access to radioactive white-gene DNA
. The position of the gene for the protein actin in the haploid fungus Neurospora is known from the complete genome sequence. If you had a slow-growing mutant thatyou suspected of being an actin mutant and you wantedto verify that it was one, would you (a) clone the mutantby using convenient restriction sites flanking the actingene and then sequence it or (b) amplify the mutantgene by using PCR and then sequence it?
Canvas Question 5 Select any of the choices that would be considered a post-transcriptional modification of pre-messenger RNA. (multiple answers expected)] O Addition of a 5' cap O Addition of a 3' poly-A tail O Removal of introns O Ligation (joining) of exons Question 6 Select any of the statements that could describe a gene mutation. [multiple answers expected] O a change in the DNA sequence of an organism O may be caused by changing the identity of a base O may arise spontaneously O may be caused by losing or adding a nucleotide hp
HELP PLEASE !! In moelcular genetics, initiation is often accomplished using proteins that prevent elongation. Name and describe 3 processes where this happens, they can be in different species. Make sure to name or describe the proteins and substrates involved and how the elongation inhibition is overcome.
construct! Which of the four constructs (Construct 1-4) below could you use to make your own mouse knockout? For each one you did not choose, explain why you did not choose that construct. Part of DHCR7 gene structure is shown on top row in the schematic. (Antibiotic selection and negative selection genes have been abbreviated.) Gene DHCR7 Intron 1 Exon 2 Intron 2 Exon 3 Exon1 Construct #1 Construct #2 Intron1 Negative Sel. Intron1 |Antibio. Sel. Negative Sel. Intron2 Antibio. Sel Intron 2 Construct #3 Construct #4 Introni Antibio. Sel Negative Sel. Negative Sel. Antibio. Sel. Intron2 Intron1 Intron2
WHAT IF? Since the results support a role for mouse FOXP2 invocalization, you might wonder whether the human FOXP2 protein is akey regulator of speech. If you were given the amino acid sequences ofwild-type and mutant human FOXP2 proteins and the wild-type chimpanzee FOXP2 protein, how would you investigate this question? What furtherclues could you obtain by comparing these sequences to that of the mouseFOXP2 protein?
. Early in development, most human cells turn off expression of an essential component of telomerase, the enzyme responsible for addition of telomere repeat sequences (5’-TTAGGG) to the ends of chromosomes. Thus, as our cells proliferate their telomeres get shorter and shorter, but are normally not lost over the course of a lifetime. If cells are removed from the body and grown in culture, however they ultimately enter a state of replicative senescence and stop dividing when their telomeres get too short. By contrast, most human tumor cells express active telomerase, allowing them to maintain their telomeres and grow beyond the normal limit imposed by senescence - good for them, bad for us. Anticipating a universal cure for cancer, you set up a company to screen chemical ‘libraries’ for telomerase inhibitors. The company share price takes a dive, however, when a rival group generates a strain of telomerase-knockout mice. These mice breed happily for several generations, but…
You have generated a new induced pluripotent stem (iPS) cell line. How would you test for the properties of this cell line to ensure it is similar to the previous iPS cells that Yamanaka and colleagues generated? All of the above RNA-seq to show that the transcriptome is similar to embryonic stem cells Generate a chimera and determine if the cell contributes to endoderm, mesoderm and ectoderm ChIP-qPCR analysis to show active histone marks at promoters of pluripotency genes Prolonged culture of cells to show ability to continually divide
. You obtain the DNA sequence of a mutant of a 2-kb genein which you are interested and it shows base differencesat three positions, all in different codons. One is a silentchange, but the other two are missense changes (they encode new amino acids). How would you demonstratethat these changes are real mutations and not sequencing errors? (Assume that sequencing is about 99.9 percent accurate.)