WHAT IF? Suppose X-rays caused a sequence changein the TATA box of a particular gene’s promoter. Howwould that affect transcription of the gene? (SeeFigure 17.9.)
Q: Q1: In your own words, define RNA splicing. When during gene expression does it occur? Q2: What do…
A: The transcriptional process is the synthesis of ribonucleic acids (RNA) from the genes of…
Q: 2. In your own words, describe two different reasons why a eukaryotic cell may need to control gene…
A: gene expression is a process to regulate the production of active gene to produce the proteins to…
Q: 7) CRSPR-cas9 has revolutionized are ability to edit genomes. How hasthe CRSPR-cas9 system increased…
A: Genome editing is a unique technology used to make specific changes to the cell’s DNA. It is a tool…
Q: Synthesize a Protein Below is a region of a gene. Transcribe the gene into a pre-mRNA strand.…
A: The DNA is the genetic material that is passed from one generation to the next generation. It is…
Q: Q.4. What is an operon? Explain an inducible operon.
A: An operon is a functional unit of DNA that contains a cluster of genes that are all controlled by a…
Q: Many types of breast cancer have chromosomal translocation mutations. What scenario best describes,…
A: *Translocation is one type of chromosomal abnormality which chromosome breaks and it's portion will…
Q: Synthesize a Protein 5. Below is a region of a gene. Transcribe the gene into a pre-mRNA strand. DNA…
A: In this question, we have to answer the mRNA sequence , processing of mature RNA and peptide chain…
Q: WHAT IF? In eukaryotic cells, mRNAs have been foundto have a circular arrangement in which proteins…
A: The central dogma of molecular biology explains the flow of genetic information through the…
Q: 0. Explain how differences in the initiation of translationdictate that eukaryotic mRNAs are…
A: An mRNA that can encode for many proteins is known as polycistronic mRNA. This mRNA is present in…
Q: 1. Which modification occurs as part of transcriptional termination? Explain this modification and…
A: 1 ) ANSWER The maturation of a eukaryotic mRNA from primary mrna transcript involve many complex…
Q: 59 Walter Gilbert coined the term ( ) for an intervening sequence that is removed during the…
A: 59. Walter Gilbert coined the term Introns for an intervening sequence that is removed during the…
Q: 10. You have developed a transcription assay that recapitulates the in vivo regulation of the…
A: As given in the question, two additional transcription factors (Click and Clack) were identified in…
Q: Yes or no? reverse genetics is RNA interference example. cellular differentiation potency in…
A: RNAi (RNA interference) is a method in which double-stranded RNA is used to suppress gene…
Q: 4. Which or which (can select more than one alternative) of the control methods of genetic…
A: Since we only answer one question at a time, we’ll answer the first one. Please resubmit the…
Q: 3.What could mutation m1 do to the rate of transcription? Increase? Decrease? Have no effect?…
A: Introduction The process of converting a piece of DNA into RNA is known as transcription. Messenger…
Q: Write down characteristics of Genetic Code?
A: The DNA or the RNA is made up of a sequence of nucleotides that direct the amino acid sequence in…
Q: WHAT IF? What would be the effect of treating cellswith an agent that removed the cap from mRNAs?
A: Ribonucleic acid (RNA) is a polymeric molecule essential in various biological roles in decoding,…
Q: Q21. What regulators of gene expression bind the lac promoter region if E. coli is grown in media…
A: In the absence of lactose the repressor binds to the operator sequence adjacent to the promoter and…
Q: Describe TWO other mechanisms for regulating gene expression that we discussed over the semester?
A: Gene expression is controlled with the help of regulatory proteins at numerous levels. These…
Q: 4. In the graph shown below, the dashed line shows the level of MRNA for a certain protein, Prot6,…
A: Anterior-posterior axis is defined by a line that runs from the head or mouth of an organism to the…
Q: Q8. Protein synthesis is carried out by the processes of transcription and translation. A short…
A: The transcription is the process by which RNA is produced from the DNA template and the translation…
Q: Q4. If you imagine a messenger RNA molecule in the cytoplasm of a cell, which of the following will…
A: Polyadenylation is a post-transcriptional modification method where the poly(A) tail is added which…
Q: Consider this short mRNA: 5’ – AUGGCAGUGCAA – 3’. Answer the following questions assuming the code…
A: DNA or deoxyribonucleic acid undergoes transcription and produces messenger RNA sequence in the form…
Q: Q9. Using the section of the genetic code below, identify the sequence of mRNA that would code for…
A: More than 150 amino acids are found in nature but only 20 are synthesized during a protein…
Q: Q. Which of the following describes the role of acetylation during the chromatin remodeling that…
A: Euchromatin consists of genes that are ready to be transcribed and translated into protein,…
Q: Review Concept 17.1 Match the term and its description. Each term can only be used once. In this two…
A: Within each cell, the process of turning a gene into a protein is complicated and closely regulated.…
Q: How the cargo of INS gene product is shuttle between ER and Cis Golgi Complex (CGC) ?
A: Introduction Endomembrane system establishes the network between some specialized organelles which…
Q: Genetics question about COVID-19. what are the mRNA codon sequences of the 2019-dominant and…
A: The currently dominant variant of SARS-CoV-2 (severe acute respiratory syndrome-coronavirus 2)…
Q: examples of how RNA secondary structure and catalytic RNAs are important in gene expression
A: The secondary structure of RNA consists of a single nucleotide. RNA folds between complimentary…
Q: Q12: The sequence below shows one strand of DNA. Parts of the sequence are in capital letters to…
A: transcription is the process by which dna molecules are used as template to form new messenger rna…
Q: Exploring Further: The table below outlines the stpes in eukaryotic gene expressions. Briefly…
A: Gene expression steps molecules involved summary Transcription mRNA, small and large ribosomal…
Q: s transcription specifically take place in the cell? s translation specifically take place in the…
A: Transcription - It is the process in which DNA is copied into RNA with the help of an enzyme RNA…
Q: 6. In the following graph, the dashed line shows the level of mRNA for a certain protein, Prot6, at…
A: The dashed line in the graph shows the level of mRNA for protein, Prot6 at various positions along…
Q: 14. a. What is the role of insulators? b. What would happen if there were no boundary elements for…
A: 14 . what is the role of insulators? Insulators are the segments of DNA that functions as a…
Q: Q. Write down the importance of post transcriptional modifications? Write in 5 to 6 points with…
A: Splicing, capping, and polyadenylation (poly-A tail addition) are the process that occurs as…
Q: 1. What is RNA? And, how is RNA modified? 2. What are the 3 major steps involved in mRNA…
A: Ribonucleic acid is a molecule similar to DNA. Unlike DNA, RNA is single-stranded.
Q: 3.) How do cis-acting regulatory elements and trans-acting regulatory proteins act in coordination…
A: A trans-acting element is usually a DNA sequence that contains a gene. This gene encodes for a…
Q: III. Discuss the following aspects of translation: 1. How does the location and timing of…
A: According to our guideline we can answer maximum 3 subparts of a question. So, you need to upload…
Q: Gene transcription/translation (circle one) is more complex than Gene transcription/translation…
A: There are four questions and I am answering the first question. According to Bartleby guidelines,…
Q: Q.) A.)Search in human genome if any examples of mRNA translated from 2 different sites?and give…
A: The process of translation is the process of gene expression. This process is characterized by the…
Q: Can you please answer 7, and 8
A: Since we are entitled to answer only one question at a time, I would be answering the first question…
Q: When dsRNA is treated with Dicer enzyme siRNA and miRNA’s are produced. What role they will play in…
A: siRNA is a type of double stranded short sequence rna which is non coding and take part in RNA…
Q: Q.1. Enumerate the post-transcriptional modifications in a eukaryotic mRNA.
A: The post transcriptional modifications :- 1 . Splicing : Here the introns are removed from the mRNA…
Q: When is transcription over? f. What is splicing, how is it operated? What about alternative…
A: The transcription is the first key step of gene expression. The process of transcription is defined…
Q: Measuring gene expression of a reporter gene (e.g. gfp) under the control of an unknown promoter…
A: A promoter is the gene sequence that serves as a site for the binding of RNA polymerase.
Q: (2017 6C) A model of a biological process is shown. MRNA 13' AGCUGACCUAG CG GACAA || GAU CG C A Asp…
A: The process of protein synthesis is a dynamic process, which involves 3 essential components namely…
Q: 3. Where does transcription specifically take place in the cell? 4. Where does translation…
A: 3. The process of transfer of genetic information from DNA to mRNA (messanger RNA) is called…
WHAT IF? Suppose X-rays caused a sequence change
in the TATA box of a particular gene’s promoter. How
would that affect transcription of the gene? (See
Figure 17.9.)
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Discuss Concepts The normal form of a gene contains the nucleotide sequence: When this gene is transcribed, the result is the following mRNA molecule: In a mutated form of the gene, two extra base pairs (underlined) are inserted: What effect will this particular mutation have on the structure of the protein encoded in the gene?A normal mRNA that reads 5’ - UGCCAUGGUAAUAACACAUGAGGCCUGAAC- 3’ has an insertion mutation that changes the sequence to 5' -UGCCAUGGUUAAUAACACAUGAGGCCUGAAC- 3’. Translate the original mRNA and the mutated mRNA, and explain how insertion mutations can have dramatic effects on proteins. (Hint: Be sure to find the initiation site.)GTTTTCACTGGCGAGCGTCATCTTCCTACT 8. What is the function (e.g. transcriptional regulation, transmembrane signaling, kinase, protease, etc.) of the protein(s) encoded by the gene.
- 4e. You also study the expression of 3 different mutants for this gene. For each mutant answer the following: Does this mutation change the sequence of the protein produced? Why or why not? If it does change the sequence of protein be sure to write out the new sequence. If it does not change the protein sequence, what effect (if any) would you expect it to have on expression of the gene? 1 20 ORI 40 60 5'...TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC...3' 3' ...AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCATTATACCCCTACGTGATAG...5' * promoter. Discuss how mutations may arise in DNA, and the potential consequences for gene function if a point mutation were to occur in (a) the coding region of a gene, and (b) the non-coding regulatory region of a gene.E 64 In the figure shown below, which of the DNA strands is the template strand, upper or lower? GTGCATCTGACTCCTGAGGAGAAG САCGTAGAСTGAGGACTССТСТТС ... ... DNA ... ... (transcription) GUGCAUCUGACUCCUGAGGAGAAG RNA •.. ... (translation) VHLT PE K protein ... Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a UPPER b. LOWER
- 4e. You also study the expression of 3 different mutants for this gene. For each mutant answer the following: Does this mutation change the sequence of the protein produced? Why or why not? If it does change the sequence of protein be sure to write out the new sequence. If it does not change the protein sequence, what effect (if any) would you expect it to have on expression of the gene? 1 20 ORI 40 60 5'..TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC...3’ 3'...AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCATTATACCCCTACGTGATAG...5’ promoter i. Mutant A has a single base pair substitution with the T/A being replaced with C/G base pair at position 35 (position denoted by the * in the sequence above). ii. Mutant B has a 2 G/C pairs inserted between position 19 and 20 (position denoted by the ^ in the sequence above).I. The retinoic acid receptor (RAR) is a transcription factor that is similar to steroid hormone receptors. Thesubstance (ligand) that binds to this receptor is retinoicacid. One of the genes whose transcription is activatedby retinoic acid binding to the receptor is myoD. Thediagram that follows shows a schematic view of theRAR proteins produced by genes into which one oftwo different 12-base double-stranded oligonucleotides had been inserted in the ORF. The insertion site(a–m) associated with each mutant protein is indicatedwith the appropriate letter on the polypeptide map.For constructs encoding proteins a–e, oligonucleotide 1(5′ TTAATTAATTAA 3′ read off either strand) wasinserted into the RAR gene. For constructs encoding proteins f–m, oligonucleotide 2 (5′ CCGGCCGGCCGG 3′)was inserted into the gene.NH2 f g h i j k l m COOHa b c d eThe wild-type RAR protein can both bind DNA and activate transcription weakly in the absence of retinoic acid(RA) and strongly in RA’s presence. Each…20 of 22 If a strand of MRNA has the sequence 5'-CUGUCA...ACUC-3' (with […] representing the intervening sequence), what was the template strand of DNA used to produce this mRNA? 3'-GACAGU...UGAG-5' 5'-CTGTCA...ACTC-3' 5'-CUGUCA...ACUC-3' 3'-CTGTCA...ACTC-5' 3'-GACAGT...TGAG-5'
- . Let’s say that you have incredible skill and can isolate the white and red patches of tissue from the Drosophila eyes shown in Figure 12-24 in order to isolate mRNA from each tissue preparation. Using your knowledge of DNA techniques from Chapter 10, design an experiment that would allow you to determine whether RNA is transcribed from the white gene in the red tissue or the whitetissue or both. If you need it, you have access to radioactive white-gene DNAIn transcription, 1. what is/are the importance of the sense and missense/antisense strands and 2. what are the importances of the series of nucleotide bases before the coding region of the locus?-If the first G get deleted what kind of mutation will happen? Show the change in amino acid sequence. deletion lead to change in reading frame (triplet grouping) of the mRNA, so that nucleotides are grouped into different codons, lead to significant changes in amino acid sequence downstream of the mutation. TACCTA-CACACATGTAGGTGGGCAAAGTT -Multiple mechanisms regulate gene expression in eukaryotes. What are the mechanisms that control the gene expression in nucleus and what are the mechanisms that control the gene expression in cytoplasm. (names not definitions)
