You have generated a new induced pluripotent stem (iPS) cell line. How would you test for the properties of this cell line to ensure it is similar to the previous iPS cells that Yamanaka and colleagues generated? All of the above RNA-seq to show that the transcriptome is similar to embryonic stem cells Generate a chimera and determine if the cell contributes to endoderm, mesoderm and ectoderm ChIP-qPCR analysis to show active histone marks at promoters of pluripotency genes Prolonged culture of cells to show ability to continually divide

You have generated a new induced pluripotent stem (iPS) cell line. How would you test for the properties of this cell line to ensure it is similar to the previous iPS cells that Yamanaka and colleagues generated? All of the above RNA-seq to show that the transcriptome is similar to embryonic stem cells Generate a chimera and determine if the cell contributes to endoderm, mesoderm and ectoderm ChIP-qPCR analysis to show active histone marks at promoters of pluripotency genes Prolonged culture of cells to show ability to continually divide

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter6: Dna Structure And Function

Section: Chapter Questions

Problem 2CT

See similar textbooks

Similar questions

Following are the characteristics of organoids, except: Organoids are in vitro 3D clusters of cells deriving exclusively from primary tissue or stem cells Organoids are capable of self-renewal and self-organization. 2D monolayer cultures are much closer to the in vivo situation than the organoids Spatially restricted cell-fate decisions contribute to self-organization in organoids.
By whole-exome sequencing, you have identified an early termination mutation in KLHL4 in a human patient with an undiagnosed blood vessel anomaly. There is almost nothing known about the function of this gene, and no existing animal models! To begin to understand its function, you decide to use the zebrafish model. You first want to know where in the embryo this gene is expressed. Which technique would you use to identify the cell type that expresses klhl4 mRNA in zebrafish embryos? You find that this gene is expressed in endothelial cells, which line blood vessels. Intrigued by this finding, you next decide to disrupt the gene in zebrafish using CRISPR/Cas9. The DNA sequence that you want to target is below. What is the sequence of your 20-base guide RNA? 5’ TAGCAATTATGCGCGCTAGCAATTGCGTAGGTCATAATGCAGCTGAC 3’ 3’ ATCGTTAATACGCGCGATCGTTAACGCATCCAGTATTACGTCGACTG 5’ After injecting the gRNA with Cas9, what are potential outcomes? Enter true or false.…
. Let’s say that you have incredible skill and can isolate the white and red patches of tissue from the Drosophila eyes shown in Figure 12-24 in order to isolate mRNA from each tissue preparation. Using your knowledge of DNA techniques from Chapter 10, design an experiment that would allow you to determine whether RNA is transcribed from the white gene in the red tissue or the whitetissue or both. If you need it, you have access to radioactive white-gene DNA
. Early in development, most human cells turn off expression of an essential component of telomerase, the enzyme responsible for addition of telomere repeat sequences (5’-TTAGGG) to the ends of chromosomes. Thus, as our cells proliferate their telomeres get shorter and shorter, but are normally not lost over the course of a lifetime. If cells are removed from the body and grown in culture, however they ultimately enter a state of replicative senescence and stop dividing when their telomeres get too short. By contrast, most human tumor cells express active telomerase, allowing them to maintain their telomeres and grow beyond the normal limit imposed by senescence - good for them, bad for us. Anticipating a universal cure for cancer, you set up a company to screen chemical ‘libraries’ for telomerase inhibitors. The company share price takes a dive, however, when a rival group generates a strain of telomerase-knockout mice. These mice breed happily for several generations, but…
In the module, you have learned about P-element mediated transgenesis in Drosophila and the concept of using transgenes to rescue mutant phenotypes. In the figure below, you will see a wild type fly with its natural eye colour and three mutants with their eye colours changed to vermillion, white and rosy, respectively. A schematic of P-element mediated transgenesis (as shown in the lectures) is also included in the figure. Please inspect the schematic carefully and choose which of the following statements is true: I. Injection of the white experimental transgene into the vermillion mutant embryo will not change the vermillion mutant phenotype II. Injection of the white experimental transgene in the rosy mutant embryo will change rosy eye colour to red (wild type) III. Injection of the white experimental transgene in the white mutant embryo will not change the white mutant phenotype IV. Injection of the white experimental transgene in the rosy mutant…
Northern blotting, RT-PCR, and microarrays can be used to analyze gene expression. A lab studies yeast cells, comparing their growth in two different sugars, glucose and galactose. One student is comparing expression of the gene HMG2 under these two conditions. Which technique(s) could he use and why? Another student wants to compare expression of all the genes on chromosome 4, of which there are approximately 800. What technique(s) could she use and why?
You are interested in studying a novel gene that appears to be involved in cancer. There is no information about the function of this gene. What would you do to obtain the cDNA for this gene? How would you express this gene and what expression systems might you utilize to study its function and why? How would determine the subcellular localization of this gene in eukaryotic cells? What are alternative methods in case one doesn't work? How would you purify and determine the 3-dimensional structure of this protein?
Would gene chips containing bacterial DNA segments be useful for monitoring gene expression in a mammalian cell?
Below are data from Jimenez et al (2022) depicting cellular expression patterns of the tumor suppressor transcription factor p53 (a gene commonly mutated in cancers). They explored oscillating expression patterns found in a mutated human cell line. Panel D shows measurements of changes in p53 mRNA levels measured using two different approaches; figure E shows measurements of protein levels from the same samples. The numbers on either side indicate the observed fold change (FC) in relative abundance of these molecules (note that any difference in values obtained between the two methods are not relevant for this question). Answer part b as pictured in the question
Describe the mechanisms in which DNA is used to generate protein. Reflect on the key points in the process and mention any major differences between the mechanism in prokaryotic and eukaryotic cells. Although the DNA in our genes is considered to be the heritable genetic material, other factors, including the environment are considered to play an important role in the activity and expression of those genes. Summarize the role that epigenetics & developmental epigenetics play in health & disease.
You are working with a fly hair cell developmental system. This Notch/Delta-regulated system results in clusters of cells where the central one differentiates into a specialized hair cell. To better understand this system you have tagged the C-terminal cytoplasmic domain of Notch with GFP. You have done a forward genetic screen to look for mutants that have unusual phenotypes in this Notch system. The first one is a mutation in Notch itself. This mutant is in the ADAM10 cleavage site and blocks proteolysis. Draw the expected outcome for such a mutant: GFP localization and developmental outcome 24hr after differentiation. WT before differentiation WT 24 hours after differentiation
Expression of recombinant proteins in yeast is an important tool for biotechnology companies that produce new drugs for human use. In an attempt to get a new gene X expressed in yeast, a researcher has integrated gene X into the yeast genome near a telomere. Will this strategy result in good expression of gene X? Why or why not? please try to explain a bit elaborately.