WHAT IF? DRAW IT The template strand of a geneincludes this sequence:3¿-TACTTGTCCGATATC-5¿. It is mutated to3¿-TACTTGTCCAATATC-5¿. For both wild-type and mutantsequences, draw the double-stranded DNA, the resultingmRNA, and the amino acid sequence each encodes. Whatis the effect of the mutation on the amino acid sequence?

WHAT IF? DRAW IT The template strand of a geneincludes this sequence:3¿-TACTTGTCCGATATC-5¿. It is mutated to3¿-TACTTGTCCAATATC-5¿. For both wild-type and mutantsequences, draw the double-stranded DNA, the resultingmRNA, and the amino acid sequence each encodes. Whatis the effect of the mutation on the amino acid sequence?

Name: WHAT IF? DRAW IT The template strand of a geneincludes this sequence:3
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: WHAT IF? DRAW IT The template strand of a geneincludes this sequence:3¿-TACTTGTCCGATATC-5¿. It is mutated to3¿-TACTTGTCCAATATC-5¿. For both wild-type and mutantsequences, draw the double-stranded DNA, the resultingmRNA, and the amino acid sequence ea

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter30: Protein Synthesis

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

HELP PLEASE !! In moelcular genetics, initiation is often accomplished using proteins that prevent elongation. Name and describe 3 processes where this happens, they can be in different species. Make sure to name or describe the proteins and substrates involved and how the elongation inhibition is overcome.
construct! Which of the four constructs (Construct 1-4) below could you use to make your own mouse knockout? For each one you did not choose, explain why you did not choose that construct. Part of DHCR7 gene structure is shown on top row in the schematic. (Antibiotic selection and negative selection genes have been abbreviated.) Gene DHCR7 Intron 1 Exon 2 Intron 2 Exon 3 Exon1 Construct #1 Construct #2 Intron1 Negative Sel. Intron1 |Antibio. Sel. Negative Sel. Intron2 Antibio. Sel Intron 2 Construct #3 Construct #4 Introni Antibio. Sel Negative Sel. Negative Sel. Antibio. Sel. Intron2 Intron1 Intron2
Cynt Classifying mutations A certain section of the coding (sense) strand of some DNA looks like this: $-ATGTATATCTCCAGTTAG-3" It's known that a very small gene is contained in this section. Classify each of the possible mutations of this DNA shown in the table below. mutant DNA 5- ATGTATCATCTCCAGTTAG-3' S-ATGTATATCTCCAGTTAG-3 5- ATGTATATATCCAGTTAG-3' type of mutation (check all that apply) insertion deletion point silent noisy insertion O deletion point silent noisy insertion O deletion point silent Onoisy X G
. The double-stranded circular DNA molecule thatforms the genome of the SV40 tumor virus can be denatured into single-stranded DNA molecules. Becausethe base composition of the two strands differs, thestrands can be separated on the basis of their densityinto two strands designated W(atson) and C(rick). When each of the purified preparations of the single strands was mixed with mRNA from cells infectedwith the virus, hybrids were formed between the RNAand DNA. Closer analysis of these hybridizationsshowed that RNAs that hybridized with the W preparation were different from RNAs that hybridized withthe C preparation. What does this tell you about thetranscription templates for the different classes ofRNAs?
1. Here is the amino acid sequence of part of a hypotheticalgene you want to clone:Pro-Arg-Tyr-Met-Cys-Trp-Ile-Leu-Met-Sera. What sequence of fi ve amino acids would give a 14-merprobe with the least degeneracy for probing a library tofi nd your gene of interest? Notice that you do not use thelast base in the fi fth codon because of its degeneracy.b. How many different 14-mers would you have to makein order to be sure that your probe matches thecorresponding sequence in your cloned gene perfectly?c. If you started your probe one amino acid to the left of theone you chose in (a), how many different 14-mers would youhave to make? Use the genetic code to determine degeneracy.
. You obtain the DNA sequence of a mutant of a 2-kb genein which you are interested and it shows base differencesat three positions, all in different codons. One is a silentchange, but the other two are missense changes (they encode new amino acids). How would you demonstratethat these changes are real mutations and not sequencing errors? (Assume that sequencing is about 99.9 percent accurate.)
pcc300ATAAADATATAOOTTAA 1. Use the genetic code table and the information in the diagram below to determine the amino acids that would make up the portion of the polypeptide shown. Include information for a key as well. DNA template 3' G CATA ACAGAGGATT-5' al bnsua AMAm pniwollot erfT E transcription s yd bnsita ebitgeqylog s sidmeaze of beae RNA strandUU UAOUOUU A-emoaodin 5'-CGUA AUUGUC UCCUUA- 3' J J JL erit o elinW (s) translation bluow terdt aspnso sigootiwsone polypeptide viemetis ns ebivo19 (d) ent ot etslanT Key:
Please help witht this homework question A- What are the topological parameters (linking number, twist, and writhe)for a relaxed, 4,200 base pair circular double-stranded DNA plasmid? LK=? Tw= ? Wr=? The CRISPR-Cas9 protein first forms a protein-RNA complex with a guide RNA, and then binds to DNA sequences that match a 20-base target sequence within the guide. When the CRISPR-Cas9 complex binds to DNA, it unwinds about 20 base pairs of the DNA double helix. B- Why is DNA unwinding required for CRISPR-Cas9 protein-RNA complexto recognize target sites? C-How would the topological parameters (linking number, twist, andwrithe) of the 4,200 bp plasmid in (A) change when the CRISPR-Cas9 complex binds the DNA and unwinds about 20 bp? Lk=? Tw=? Wr=? D- What is the linking number after the CRISPR-Cas9 complex cleaves theDNA?
GTTTTCACTGGCGAGCGTCATCTTCCTACT 1. Identify the gene from which the query sequence originates (Name of the gene)2. Provide the FULL protein sequence encoded by the gene.3. Are different splice variants known for this gene?4. What human disease has been connected to this gene?5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where theprotein carries no net electrical charge) of the protein.6. Provide the reference (in proper reference form: Author; Year; Title; JournalName; Volume; Page Numbers) for a recent publication involving the identifiedgene. This reference should NOT be a web page reference.7. Are there homologs for the identified gene in other systems? Identify one homolog in an invertebrate system (if there is none, provide a vertebratehomolog).8. What is the function (e.g. transcriptional regulation, transmembrane signaling,kinase, protease, etc.) of the protein(s) encoded by the gene.9. Generate a FULL protein sequence alignment for one of the…
2ith the diagram provided please write the polypeptide. sequence obtained from the translation of the black allele gene
Great! Now you have the gene sequence. Now you would like to clone it into an expression vector to grow up in a bacterial system. Because you're going to use bacteria to generate protein from a eukaryote, the mammoth, you need to get rid of introns from your sequence. How do you do that? O Bioinformatically, I look for splice-site sequences and branch-point adenines and predict intron-exon boundaries O l use a comparative genomic approach and use sequence homology with the genome of a closely related species O luse a comparative genomic approach and use sequence homology with the genome of a distantly related species O Both A and B O Both B and C
Mutation #2: • Change the Mutation to RED TACACC TIG GC GACGACT A U GU G G A A C C G C UG CUGA MET -TRP- ASN - ARG- CYS - (STOP) Original DNA Sequence: MRNA Sequence: Amino Acid Sequence: Mutated TAC GÁC CTT GGC GAC GÁC T DNA mRNA Amino Acid Will this mutation have an effect? What kind of mutation is this? Mutation #3: • Change the Mutation to RED TACACCTT G G C G A C GACT AUGUG G A A C C G C U G C U G A MET -TRP- ASN - ARG- CYS - (STOP) Original DNA Sequence: mRNA Sequence: Amino Acid Sequence: Mutated TAC ACC TTA GCG ACG ACT DNA MRNA Amino Acid Will this mutation have an effect? What kind of mutation is