Help pls !! You are looking at a region of the genome that codes for a gene involved in enamel syntheiss. You do not have a transcripome (RNA sequence). Outline a protocol for deducing the ORF and the protein sequence.
Q: Define optical activity? What is the difference between D/L System of nomenclature?
A: Light is a electromagnetic field. It consists of two different fields. The light waves oscillate in...
Q: Question 29 Sponges A Cnidarians Ancestral colonial protist Flatworms Molluscs В Annelids Nematodes ...
A: Theory and practice of classifying organisms is termed as taxonomic. The word taxis means arrangemen...
Q: In the self of a polygenic trihybrid R1/r1 ; R2/r2 ; R3/r3,use the product and sum rules to calculat...
A: When a self cross takes place between the polygenic hybrid, then: The probability in which only one...
Q: Coding With the given coding strand perform the following 1. supply the correct non- coding strand...
A: DNA is a double helical molecule.
Q: 4. In pea plants, the round shape (R) is dominant over wrinkled shape (r) for seed shape and tall (T...
A: Mendel who proposed principles of mendelian inheritance
Q: An area(s) of the brain long recognized as crucial to overall arousal and attention is the: left hem...
A: Thalamus plays crucial role in attention and arousal (consciousness level)
Q: Why living things over time have changed?
A: Introduction: Evolution is a change in the characteristics of living things over time.In natural sel...
Q: Fragile X syndrome What are the symptoms or characteristics of this disorder or trait? What is the ...
A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question s...
Q: Which one of the following features is common to both RNA and DNA? Contain just four types of bases ...
A: DNA and RNA both are nucleotides that contain genetic information of the organism. RNA is produced f...
Q: Giving details diagram the process of tetrasporic megagametogenesis. Give full details
A: INTRODUCTION It is a process of maturing female gametophyte in plant production. In the female ...
Q: Explain in detail, how did Candida famata contaminate or spoiled the snail meat?
A: Candida famata is a fungus that lives in the snail meat, and while its presence doesn't indicate spo...
Q: Why is the orientation of the bases on the inside of the DNA molecule important to the structure and...
A: DNA is an organic molecule that includes genetic information as well as instructions for protein cre...
Q: Unlike prokaryotes, eukaryotes contain membrane-bound organelles. Which of the following is NOT a be...
A: Eukaryotic cells have membrane-bound organelles such as the nucleus and mitochondria.
Q: 3. A woman has a rare abnormality of the eyelids called ptosis, which makes it impossible for her to...
A: Gene expression is the mechanism through which genetic code is used to create a functioning gene pro...
Q: #5 Explain how and where auroras occur in the atmosphere. #7 Describe the interaction between the at...
A: An atmosphere is a layer of gas that surrounds a planet and is kept in location by the gravity of th...
Q: What are the barriers that affects the mating of species (in relationship with inbreeding)?
A: Introduction :- A species is the biggest collection of organisms in which any two individuals of the...
Q: Which of the following terms are used to apply ONLY TO SELECTION, and never to just evolution. Choos...
A: Founder effect:- the reduced genetic diversity which results when a population is descended from a s...
Q: Examples of bacterial genera that cannot be cultured using artificial media
A: Bacteria usually has very low nutritional requirement and hence can be easily cultured in artificial...
Q: I have parallel leaf veins, flower parts in 3 and a fibrous root system. What am I? Group of answer ...
A: Monocots contains single cotyledon, parallel-veined leaves, scattered vascular bundles in the stem,...
Q: 00 PR 3. Which of the following is characteristic of reciprocal translocation? O a. Parts of two hom...
A: Given: A sudden change cause in a genetic material is called mutation.The mutation may occurs due to...
Q: Define the Regulation of gene expression in bacteria ?
A: All the cells contain genes in them. Genes carry the information on hereditary material. Genes are p...
Q: Study guide 15
A: In sublingual administration the tablet is allowed to dissolve completely in the oral cavity. It tak...
Q: Give the methods of transposition ?
A: Deoxyribonucleic acid or DNA is a hereditary material that transfers from one generation to another....
Q: What are the specific ways in which individuals and environments interact?
A: In this nature, individual and environment are interactive with each other. Interaction is necessary...
Q: How genes store genetic information ?
A: Introduction: Genetic information must be passed on from one generation to another, be it a eukaryot...
Q: If heritability of dots is zero: Group of answer choices Offspring will have no dots. Offspring will...
A: The sum of all biological mechanisms by which certain features are passed down from parents to their...
Q: virion. Describe how the Baltimore classification system classifies viruses.
A: An infectious agent that can only replicate within a host organism is commonly refers as the virus. ...
Q: Where on the tree did Bilateral Symmetry Evolve? O A O B O D O E
A: Few important points : Body symmetry is the similarity of parts in different regions and direction o...
Q: Which of the following protists photosynthesize? Group of answer choices Autotrophs Heterotrophs Mi...
A: According to the question, we have to find out which of the following protists can photosynthesize. ...
Q: In preparying cells for karyotyping, a hypotonic solution is used in the process. What is the purpo...
A: Cytogenetics is the science or study of chromosomes.
Q: 1A) When you have extreme inbreeding (i.e. same genotypes mate to give rise to the next generation),...
A: Introduction A phenotype is a set of observable characteristics about a person, such as height, eye ...
Q: In what way is diversity intrinsically valuable to a population? How is genotypic or phenotypic dive...
A: Genetic diversity refers to the total number of genetic features in a species' genetic composition; ...
Q: Define the role of lactose in induction ?
A: Their are wide range of meaning of induction in biology with respective to branches of biology.In em...
Q: 1. Are Cnidarians sessile or free-living? Does this distinction depend on body type? If so explain 2...
A: According to our guidelines we can solve only first three sub-parts and rest of the questions can be...
Q: HIV what is the genome for the virus? And, what Baltimore class does the virus belong to? does the v...
A: Note: As Per Bartleby Guidelines For Further Answers Please Repost The Question. Introduction: AIDS...
Q: Pick one biologic material. List it, then explain how it responds to loading. . What properties of t...
A: Biological materials are natural biocompatible materials that make up all or part of a living struct...
Q: Describe how direction is determined in nucleic acids. Also identify the "normal" direction that is ...
A: The nitrogenous bases are stacked in the interior in pairs, like the steps of a staircase; the pairs...
Q: SPLIT DNA mRNA TRNA Codon Anticodon Amino Acid A T C G G C A T A G T A A
A: The DNA is the genetic material that is responsible for the production of RNA transcription process....
Q: Why did the lab technicians need to mechanically crush the microbes and chemically dissolve their ce...
A: Introduction DNA extraction is a technique for isolating DNA from cell membranes, proteins, and othe...
Q: Contrast and compare the mutagenic effects of deaminatingagents, alkylating agents, and base analogs...
A: Mutagens are substances that damage DNA and can cause permanent changes (mutations) in the DNA seque...
Q: Chemotrophic energy metabolism is a catabolic and exergonic process that produces ATP from oxidizing...
A: Chemotrophs are organisms that get energy through the oxidation of electron givers in their environm...
Q: Differentiate the respiratory tract between the Mammals and Avian.
A: INTRODUCTION Differentiation between avian and mammalian respiratory system is given below.
Q: An organism of the genus Staphylococcus is genus Spirochaeta is while and organism of the rod shaped...
A: 1) The shape of streptococcus bacteria is spherical or circular thus they are called as coccus. Whil...
Q: Ascaris is good for chromosomal identification because a. Mitosis occurs every 0.5 seconds....
A: Ascaris is a type of roundworm.
Q: What is cisacting site ?
A: cis means " same side". The cis acting site acts as a site of DNA or RNA which helps in regulating t...
Q: Why is fatigue strength important for metallic biomaterials?
A: A biomaterial is described as a substance that has been designed to take a shape that is utilized to...
Q: 5 7. Cross a parent with IAIA Blood type with a parent IBIB Blood type. What are the phenotypes and ...
A: Blood is the fluid that circulate through our body. There are mainly four types of the blood group f...
Q: Why do we say that life is based on carbon
A: Catenation is a process in which atoms (carbon) are able to form a bond with other atoms of the same...
Q: A. Entamoeba hartmanni B. Entamoeba coli C. Entamoeba polecki
A: Note: As Per Guidelines, We Can Answer One Question or 3 subparts per question. Ask Again To get res...
Help pls !! You are looking at a region of the genome that codes for a gene involved in enamel syntheiss. You do not have a transcripome (RNA sequence). Outline a protocol for deducing the ORF and the protein sequence.
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- GTTTTCACTGGCGAGCGTCATCTTCCTACT 1. Identify the gene from which the query sequence originates (Name of the gene)2. Provide the FULL protein sequence encoded by the gene.3. Are different splice variants known for this gene?4. What human disease has been connected to this gene?5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where theprotein carries no net electrical charge) of the protein.6. Provide the reference (in proper reference form: Author; Year; Title; JournalName; Volume; Page Numbers) for a recent publication involving the identifiedgene. This reference should NOT be a web page reference.7. Are there homologs for the identified gene in other systems? Identify one homolog in an invertebrate system (if there is none, provide a vertebratehomolog).8. What is the function (e.g. transcriptional regulation, transmembrane signaling,kinase, protease, etc.) of the protein(s) encoded by the gene.9. Generate a FULL protein sequence alignment for one of the…HELP PLEASE !! In moelcular genetics, initiation is often accomplished using proteins that prevent elongation. Name and describe 3 processes where this happens, they can be in different species. Make sure to name or describe the proteins and substrates involved and how the elongation inhibition is overcome.PLEASE ANSWER ALL OF THEM. THEY ARE ALL CONNECTED MUTATION: Fill in the correct nucleotide base pairing and amino acid sequence of the mutated DNA. 1.. What is the 3’-5’ DNA sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) 2. What is the mRNA sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) 3. What is the tRNA sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) 4. What is the amino acid sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) 5. What is the most convincing type of mutation had occurred? (Frameshift resulting Missense; Frameshift resulting Nonsense; Substitution – Silent; Substitution – Missense; Substitution – Nonsense)
- construct! Which of the four constructs (Construct 1-4) below could you use to make your own mouse knockout? For each one you did not choose, explain why you did not choose that construct. Part of DHCR7 gene structure is shown on top row in the schematic. (Antibiotic selection and negative selection genes have been abbreviated.) Gene DHCR7 Intron 1 Exon 2 Intron 2 Exon 3 Exon1 Construct #1 Construct #2 Intron1 Negative Sel. Intron1 |Antibio. Sel. Negative Sel. Intron2 Antibio. Sel Intron 2 Construct #3 Construct #4 Introni Antibio. Sel Negative Sel. Negative Sel. Antibio. Sel. Intron2 Intron1 Intron2Primers designing for epitope tagging: Design forward and reverse primers to amplify the following gene with 6×HIS-tag on the N-terminus of the protein. To be cleaved and inserted into the plasmid, add restriction sites for EcoRI and HindIII at 5' and 3'. ATGCTCTCCGCCCTCGCCCGGCCTGTCAGCGCTGCTCTCCGCCGCAGCTTCAGCACCTCAGCC CAGAACAATGCTAAAGTAGCTGTGCTAGGGGCCTCTGGAGGCATCGGGCAGCCACTTTCAC TTCTCCTGAAGAACAGCCCCTTGGTGAGCCGCCTGACCCTCTATGATATCGCGCACACACCC GGAGTGGCCGCAGATCTGAGCCACATCGAGACCAAAGCCGCTGTGAAAGGCTACCTCGGAC CTGAACAGCTGCCTGACTGCCTGAAAGGTTGTGATGTGTAANeed help:, The rRNAs are isolated from the large subunit of a bacterial ribosome and separated by density gradient centrifugation. Draw the resulting density gradient and label the bands observed. Which rRNA is longest?
- CA Live Remote Consider the following chart: What type of mutation is this? * DNA: TAC GCA TGG AAT MRNA: AUG CGU ACC UUA Amino acids: Met-Arg-Thr-Leu DNA: TAC GTA TGG AAT MRNA: AUG CAU ACC UUA Amino acids: Met - His - Thr- Leu substitution deletion insertion frameshift mutation1Need help:. draw valine-aminoacyl tRNA synthetase. Show the tRNAs and the valine amino acid. You can use the one-letter code for valine (V) and do not have to draw the amino acid structure. Label the tRNA and amino acid binding sites on the enzyme. Explain the function of valine-aminoacyl tRNA synthetase and explain why there are 20 related enzymes in every cell.Refer to the DNA sequence provided: 3’ -TACTGAAGCGGCAGCCCCGCATGAGTAGACCTTACT-5’ a. What is the mRNA transcript of the anticoding strand of the DNA model? b. What is the amino acid sequence of the polypeptide chain that will be translated from the mRNA in (a)?
- Remember: for every DNA and RNA sequence you determine in this assignment, do not forget to indicate the 5' and 3' ends The following is the DNA template strand for a specific gene. The sequence does not include a promoter region or the terminator region. 3' | A|C|A| |GT|G|T|ATAA A A CC G|CGIIT TCTCC|AG|CT|T|G|C|G|G|G| G|G|A|T|T|G|C|G|C|A |A G CCAAA|G|ACAA|TAGG|ATACGTA |ATCTTT| 5' 1. Write the complementary coding strand sequence 5' GGG ATG TCA CAC ATA TTT 2. Write the MRNA primary transcript sequence 5' GGG AUG UCA CÁC AUA UUU 1 2 3 4 5 6Now you have the gene sequence. Now you would like to clone it into an expression vector to grow up in a bacterial system. Because you're going to use bacteria to generate protein from a eukaryote, the mammoth, you need to get rid of introns from your sequence. How do you do that? Bioinformatically, I look for splice-site sequences and branch-point adenines and predict intron-exon boundaries I use a comparative genomic approach and use sequence homology with the genome of a closely related species I use a comparative genomic approach and use sequence homology with the genome of a distantly related species Both A and B Both B and C Why did you bother to identify the introns? So that I could include them in the sequence to understand intron function. So that I could exclude them from the sequence because prokaryotes don't have spliceosomal machinery. So that I could see how introns affect protein folding.BIOINFORMATICS Please solve the questions about(Akt 1) can use NCBI Please help me 1.What is the official genename of the gene? Do you have another names? 2.Find nucleotide sequence of reference sequence of your gene. 3.Find refseq transcript number of your gene. Make BLAST of two of refseq transcript. Show the Blast result. (You can take screenshots) 4.Find refseq protein sequence number of your gene. And download the amino acid sequence of your gene. 5.What is the chromosome number is it located? 6.What are the coordinates of the gene? 7.How many bp is the length of the transcript? (Hint: not RefSeq transcript) 8.What is the transcript access number? 9.How many exons and introns does it have? 10. What is the sequence of the first exon? 11.How many nucleotides long is each exon? 12. What is the UniProt accesion number of your genes for human?