WHAT IF? Suppose the mRNA being degraded in Figure18.14 coded for a protein that promotes cell division ina multicellular organism. What would happen if a mutation disabled the gene for the miRNA that triggers thisdegradation?
Q: 4e. You also study the expression of 3 different mutants for this gene. For each mutant answer the…
A: Promoted is the sequence of nucleotides found in the DNA for binding of transcription factor during…
Q: Model 1: What conditions would need to be present in the cell in order to reverse the regulatory…
A: The operon is the system that explains the regulation of gene expression in terms of switching “on”…
Q: 1. Bioinformatics analyses of the genomes of cancer cells from many different patients with…
A: Introduction Cancer is a disease in which some cells in the body grow out of control and spread to…
Q: MAKE CONNECTIONS How is ligand binding similarto the process of allosteric regulation of…
A: Ligands are the molecules that bind to a receptor and change the confirmation of the receptor. It…
Q: A cell has a mutation which renders ligase non-functional. How does this affect the cell’s function?…
A: A mutation is a change in a DNA sequence. It can result from DNA copying mistakes made during cell…
Q: 26.With regard to cell signalling, which of the following do not represent exogenous signals? A.…
A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction:…
Q: This figure below shows the organization of a protein that will end up in the ER membrane . The…
A: Translocation: The term translocation is the process or a genetic change that occurs when a piece of…
Q: ext, let's work through the 1st part of the process: TRANSCRIPTION. sing the sequence found in the…
A: The method of copying a part of DNA into RNA is known as transcription. Messenger RNA is made up of…
Q: 1. You are stuaying regulation of peri gene expi amounts of Per1 mRNA and protein in normal cells…
A: PER1 transcription is regulated by protein interactions with its five E-box and one D-box elements…
Q: Yes or no? reverse genetics is RNA interference example. cellular differentiation potency in…
A: RNAi (RNA interference) is a method in which double-stranded RNA is used to suppress gene…
Q: 4. What is the use of miRNAs in the cell? Please discuss the effect of a mutant Argonaute protein on…
A: RNA (ribonucleic acid) is a polymer of nucleotides that is composed of pentose sugar, a nitrogen…
Q: Part II: Fill in the blank: IL-04,5,6 1- The addition of more subunits at either end of MTs is…
A: Actin and myosin Actin is a globular protein that gives space and mobility to the person. myosin is…
Q: Help pls !! You are looking at a region of the genome that codes for a gene involved in enamel…
A: A gene can be described as the complete set of genetic data present in an organism. This data is…
Q: . Explain the process of transcription in cells?
A: The central dogma of molecular biology, given by Dr. Francis Crick states that the information…
Q: Imagine that you are working with DNA sequences of membrane proteins) and have the technology to…
A: Protein synthesis can be mediated by membrane free ribosome or membrane bound ribosome. Actually the…
Q: ec61 is a protein involved in the formation of the translocon for ER-targeted proteins. What would…
A: The protein translocon is found within the membrane of the endoplasmic reticulum (ER) of nucleated…
Q: Q8. Protein synthesis is carried out by the processes of transcription and translation. A short…
A: The transcription is the process by which RNA is produced from the DNA template and the translation…
Q: Consider this short mRNA: 5’ – AUGGCAGUGCAA – 3’. Answer the following questions assuming the code…
A: DNA or deoxyribonucleic acid undergoes transcription and produces messenger RNA sequence in the form…
Q: Q34. mRNA decay (breakdown) can play an important role in controlling protein abundance. Which of…
A: mRNA decay or break down takes place in our cell when specific mRNAs are not required anymore and is…
Q: Q9. Using the section of the genetic code below, identify the sequence of mRNA that would code for…
A: More than 150 amino acids are found in nature but only 20 are synthesized during a protein…
Q: Review Concept 17.1 Match the term and its description. Each term can only be used once. In this two…
A: Within each cell, the process of turning a gene into a protein is complicated and closely regulated.…
Q: .Describe the process of transcription in prokaryotes, then explain how proteins can be targeted for…
A: The bacterial genome is comprised of circular DNA present in the cytoplasm and does not have…
Q: 2.) Give one example of a trans-acting regulatory protein.
A: In context of transcription, a trans-acting element is usually a DNA sequence that contains a gene.…
Q: 21.Trace a protein molecule from the mRNA for it leaving the nucleus to its secretion from the cell.…
A: Cytosolic protein lack N terminal signal peptide. Translation completes on free cytosolic ribosomes.…
Q: Dynamic instability causes microtubules either to grow or to shrink rapidly. Consider an individual…
A: Within the cell three types of cytoskeleton proteins are found that are- microfilament, intermediate…
Q: 2) Briefly describe 6 different ways that eukaryotic cells typically regulate Gene Expression
A: Gene expression is the process by which a particular or a set of genes are expressed with the help…
Q: WHAT IF? A certain mutation in E. coli changes the lacoperator so that the active repressor cannot…
A: Step 1 Lactose Operon (Inducible Operon System) is a regulated operon system in which the structural…
Q: Q12: The sequence below shows one strand of DNA. Parts of the sequence are in capital letters to…
A: transcription is the process by which dna molecules are used as template to form new messenger rna…
Q: Exploring Further: The table below outlines the stpes in eukaryotic gene expressions. Briefly…
A: Gene expression steps molecules involved summary Transcription mRNA, small and large ribosomal…
Q: 17 Addition of the transcription factors KIf4, Sox2 and Oct4 to a fully differentiated cell, leads…
A: Cell potency is the ability of the cell to differentiate into different cell types. Similarly, stem…
Q: 9. A gene being expressed has the following partial DNA sequence: TACCAACCTACA. What would be the…
A: Here I will provide you mRNA sequence as well as amino acids sequences of the given DNA sequences.
Q: 2. The yeast gene encoding a protein found in themitotic spindle was cloned by a laboratory…
A: A protein is encoded by the yeast gene that is found in the mitotic spindle. This gene is cloned by…
Q: What is a KDEL motif? A The KDEL motif functions as a stop-transfer sequence in Type I membrane…
A: The KDEL receptor is a protein with seven transmembrane domains that was discovered about 20 years…
Q: Liver cells proliferate excessively both in patients with chronic alcoholism and in patients with…
A: Alcohol is an apoptotic compound which means either cell can be killed because of necrosis or by…
Q: please answer asap! ty!!! Why are phosphorylation, acetylation and methylation of proteins…
A: Post-translational modification of proteins refers to the covalent modification of proteins…
Q: The fabrication of 3D printers cellular scaffolds for cancer research. Would this process is viable?…
A: Scaffolding provides structure and support to the cells and subsequently tissues It helps the cell…
Q: cion 18 latch Column A with Column B. v transports amino acids to the site of protein synthesis A…
A: The ribonucleic acid consists of a single stranded structure which consists of a ribose sugar. It…
Q: Think about the types of cellular processes that occur within the nucleus of a cell and the types of…
A: The nuclear chamber is defined by the nuclear envelope, which encloses the DNA. Nuclear pore…
Q: Stem cell What is the debate about between President Bush and President Obama?
A: A stem cell is a cell with the unique ability to develop into specialized cell types in the body. In…
Q: Q. Describe the different methods the cells use to restrict proteins to specific regions of the…
A: Biological membranes are divided into specific functional areas with distinct compositions that can…
Q: 4e. You also study the expression of 3 different mutants for this gene. For each mutant answer the…
A: [Note: Although the question mentions 3 mutants, only two were given. So, we will answer for the two…
Q: how have microarrays demonstrated that, all cells of an organism have the same genome, some genes…
A: Lab-on-a-chip is another name for microarray. This method is used to simultaneously evaluate the…
Q: WHAT IF? In Figure 18.17b, the lower cell is synthesizingsignaling molecules, whereas the upper cell…
A: Cytoplasmic determinants are crucial during the embryo development.
Q: 4) RNAI is the name used to describe a system that cells use to shut down the translation of…
A: ANSWER;- RNAi is mainly of two types: small interfering RNA(siRNA)- which are made artificially or…
Q: Ligands are extracellular proteins involved in signalling. Explain how a typical ligand is secreted…
A: Communication between cells takes place through chemical signals. These chemical signals called…
Q: (2017 6C) A model of a biological process is shown. MRNA 13' AGCUGACCUAG CG GACAA || GAU CG C A Asp…
A: The process of protein synthesis is a dynamic process, which involves 3 essential components namely…
Q: 5. Compare and contrast transcription and translation. Transcription Translation What is the Start…
A: The central dogma of molecular biology explains the conversion of genetic information from DNA to…
Q: Q3. (а) You are delighted to be informed that you will be receiving the COMIRNATY MRNA vaccine that…
A: By the Bartleby guidelines, only one question is supposed to be answered. The first question has…
Q: Q1) Give the reason of the following: a- Red blood cells are rounded disks and lack the nucleus. b-…
A: An organelle is a specialised subunit of a cell that has a defined role in cell biology. Organelle…
Q: WHAT IF? Suppose X-rays caused a sequence changein the TATA box of a particular gene’s promoter.…
A: The non-coding DNA sequence that is found in the core promoter region of genes in archaea and…
WHAT IF? Suppose the mRNA being degraded in Figure
18.14 coded for a protein that promotes cell division in
a multicellular organism. What would happen if a mutation disabled the gene for the miRNA that triggers this
degradation?
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- A scientist mutates elF-2 to eliminate its GTP hydrolysis capability. How would this mutated form of elF-2 alter translation? Initiation factors would not be able to bind to mRNA The large ribosomal subunit would not be able to interact with itiRNA transcripts tRNAi-Met would not scan mRNA transcripts for the start codon elF-2 would not be able to interact with the small ribosomal subunit.Hey, I need help with this: Describe the main events that occur after transcription to generate a mature mRNA and ensure its correct localisation in the cell. Please include splicing, 5' and 3' modifications, RNA export from the nucleus, and how some mRNAs are localised within the cytoplasm. Please be very detailed and long explanation ,and dont copy from google answer in your own words asap pleaseYes or no? reverse genetics is RNA interference example. cellular differentiation potency in multipotent is greater than pluripotent stem cell. does digoxigenin UTO use to make dsrna and perform rna interference?
- Q14: The figure below shows a ribosome in the process of translating an mRNA with the sequence: 5'..AUGCCGUAUGCUCUUUA...3' Elongation 3 5 3 3 LAUGEEGUAUGCU UACGGC CG AUGC EUT P sitez UAC A site A Met Pro Pro Met Anticodon Met Amino Incoming- tRNA terminus Pro © 2001 Sinauer Associates, Inc. The right side shows the ribosome with an empty A site aligned with the codon 5’UAU 3’. The next tRNA to occupy the A site on the ribosome will have what anti-codon sequence ( label 5' and 3’)? Keep in mind the wobble pairing rules and make sure your answer is consistent with the genetic code. Explain your answer. а. b. Suppose, just as the ribosome started translating the mRNA, the cell suddenly lost all of its alanine tRNAs. Using the figure above as a guide, draw and label the state the ribosome would arrest in.| What is translational repression? Explain why do cells use translational regulation to respond to signal cues like heat shock in the environment ? NUCLEUS CYTOSOL RNA transport translation control protein activity control control RNA transcript mRNA 1 3 MRNA. inactive protein DNA. -protein. transcriptional control RNA nuclear pore processing control nuclear envelope10 shown below is a schematic drawing of a gene, with the transcription unit divided into numbered regions. The arrows indicate transcription initiation sites. 'D' indicates a splice donor site. 'A' indicates a splice acceptor site and 'An' indicates a Polyadenylation signal. give all the possible fully processed mRNAs that could be produced from transcripts of this gene. List the regions that would be included in each mRNA by number
- AGUC 24. Use the table below to answer the following question. The template strand of a gene contains this sequence: 3'-TAC TAG GCT AGT TGA-5'. A mutation occurs due to exposure to a chemical mutagen that changes the gene sequence to 3'-TAC TAG ACT AGT TGA-5'. How does this mutation affect the resulting amino acid sequence? (LS3-2) * Second mRNA base A UCU UGU Cys UGC UUU UAU Tyr UAC Phe UUC U UCC Ser UCA Phe Gly (G) Leu Glu (F) (L) UUA UAA Stop UGA Stop A Ser Asp (E) (D) Leu (S) UCG UUG UAG Stop UGG Trp Tyr (Y) Ala CUU CCU CAU CGU U (A) His C G U A CỤC Leu CUA CC Pro CCA CAC CGC Arg CGA Cys (C) G A Val CAA (V) Gln G Trp (W) CUG CCG CAG CGG G Arg (R) G А С A Leu AUU ACU AAU AGU (L) Asn Ser Ser (S) AUC Ile ACC Thr ACA AAC AGC C/ Lys (K) UGA AUA Pro AAA Lys AAG AGA Arg AGG Asn (N) (P) AUG Met or start ACG His Thr (T) Gin (H) (Q) GUU GCU GAU GGU lle Asp Arg (R) (1) GUC Val GUA GCC GAC GGC Ala GCA Gly GGA GAA Glu GAG GUG GCG GGG The mutation changes a single amino acid to another amino…Date: Class: Name: RNA Modification Questions Answer the following questions. 1. What is the initial transcript called? 2. What is the final messenger MRNA called? 3. What two things are added to the messenger RNA? 4. What fragments are removed from the messenger RNA? 5. Why are the poly A tail and methyl G cap important? 6. Below, on the left, are the sequences of 3 pre-mRNAs. The exons are underlined and the introns are not underlined. Draw the mature mRNA's (ready to leave the nucleus) below each pre-mRNA. a. AUGGGGCCCAAACCCCAGUUUUAA b. AUGCAGUUGUUACGCCAAGGCCCGCGCGAUAG c. AUGUCAUGUAUCAUGUAUGUAUGUAUGUAUGUAGUAUGUAGUAUGUUUGUAUAAA (C) 2015 Bethany Lau.RNAi... result in product of dsrna or sirna to sirna or mirna! does it increase or decrease target gene expression?
- E27. A cloned gene fragment contains a regulatory element that is recog- nized by a regulatory transcription factor. Previous experiments have shown that the presence of a hormone results in transcriptional acti- vation by this transcription factor. To study this effect, you conduct a electrophoretic mobility shift assay and obtain the following results: Tube: 1 2 3 Transcription factor: Hormone: Explain the action of the hormone.-If the first G get deleted what kind of mutation will happen? Show the change in amino acid sequence. deletion lead to change in reading frame (triplet grouping) of the mRNA, so that nucleotides are grouped into different codons, lead to significant changes in amino acid sequence downstream of the mutation. TACCTA-CACACATGTAGGTGGGCAAAGTT -Multiple mechanisms regulate gene expression in eukaryotes. What are the mechanisms that control the gene expression in nucleus and what are the mechanisms that control the gene expression in cytoplasm. (names not definitions)Match the protein on the left with the mechanism of how the protein is activated on the right. Beclin-1 XBP-1s Rheb LC3 IRE-1 [Choose] [Choose] Phosphorylation Binding another protein to form a complex Dephosphorylation Cleavage Binding of GTP Dimerization Splicing in cytoplasm [Choose] [Choose]
