Q4. If you imagine a messenger RNA molecule in the cytoplasm of a cell, which of the following will likely affect how much protein is made by translation of this message? A. The presence of appropriate snRNPs. B. The length of the polyA tail. C. The strength of hydrogen bonds holding the mRNA to ribosomal RNA. D. The ability of the mRNA to pair with itself to form a helix-turn-helix structure.

Q4. If you imagine a messenger RNA molecule in the cytoplasm of a cell, which of the following will likely affect how much protein is made by translation of this message? A. The presence of appropriate snRNPs. B. The length of the polyA tail. C. The strength of hydrogen bonds holding the mRNA to ribosomal RNA. D. The ability of the mRNA to pair with itself to form a helix-turn-helix structure.

Name: Q4. If you imagine a messenger RNA molecule in the cytoplasm of a cell
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Q4. If you imagine a messenger RNA molecule in the cytoplasm of a cell, which of the following will likely affect how much protein is made by translation of this message? A. The presence of appropriate snRNPs.B. The length of the polyA tail.C. The st

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter15: From Dna To Protein

Section: Chapter Questions

Problem 5TYK: Which of the following statements is false? a. GTP is an energy source during various stages of...

See similar textbooks

Similar questions

1. True or false for these statements: a. ubiquitin molecule signals that a protein is ready to be transported to the endoplasmic reticulum b. In the ribosome during translation, the incoming tRNA will transfer its amino acid to the outgoing tRNA c.Folding of nascent or new proteins occurs after the full-length polypeptide chain has been separated from the ribosome after translation d. A signal peptide may or may not be degraded once it has guided the polypeptide to the endoplasmic reticulum
A. The diagram below shows a tRNA molecule. (i) Which part of a cell is the tRNA produced? (ii) Which part of this tRNA molecule (X, Y, Z) is amino acid attached to? Is ATP or GTP required in the formation of this attachment? (iii) Which part of this tRNA molecule (X, Y, Z) binds to mRNA? Name the bond formed at this part of tRNA with mRNA. (iv) Write the sequence of consecutive Z and amino acid sequence corresponding to the following mRNA sequence. 3' AUGCCGUACUAG 5' In your answer, copy the mRNA sequence. Below the mRNA sequence, write the TRNA sequence with 5' & 3' labels (from left to right), AND the amino acid sequence.
Genetic expression involves transcription and translation. Match the structure or molecule to the step. a. promoter region b. RNA polymerase c. antisense strand d. poly-A tail е. 5 саp f. splicing g. anticodon loop h. acceptor stem i. peptide bond j. A site 57. transcribed strand that will go on to translation 58. site where tRNA with amino acid enters the ribosome 59. intron sequences are removed and exons are combined together 60. site where amino acid combines with tRNA
3a. Select all the correct types of RNA that are both the product of transcription and are also translated in the cytoplasm. ☐ snRNAs ☐ pre-tRNAs ☐ rRNA ☐ tRNA ☐ miRNA ☐ mRNA 3b. The ribozyme found in the ribosome catalyzes ... (which of the following?) a. the synthesis of pre-mRNA as part of the transcription process. b. the formation of the peptide bond. c. the association between the large and small ribosomal subunits. d. a reaction that uses RNA as a substrate.
. Explain why it is that the anticodon sequence AGG can bind to multiple different Serine codons. 2. Let’s say you have a mutation in IF1 that makes it bind the small ribosomal subunit inefficiently. What stage, initiation, elongation or termination would the mutation effect? Explain your answer.
1. Translation a)Explain the role of ribosomes in the process of protein translation.b. Explain the role of tRNA molecules in protein translation.c. Define the following terms:1. codon 2. anticodon. Explain how a codon is used in the process of translation.
3. Given the following DNA molecule: 3' T 5' cG G T АА А АСТ А | | | | | | | | | | | АT G C САТ ТТТGА 5' - A 3.
. Given the following nucleotide sequence, 5’-CATTAGATCG-3’, find the correct complementary strand a. 5’-CGATCTAATG-3’ b. 3’-TGCCGAGCTA-5’ c. 3’-GTAATCTAGC-5’ d. 3’-CATTAGATCG-5’ Coupling of transcription and translation is found where? near type II RNA polymerase activity in prokaryotic cells within the eukaryotic nucleus at the ribosomal complex pls answer
Transcription & Translation A. Describe mRNA splicing. B.How do mRNA and rRNA interact? C.How do mRNA and tRNA interact?
1. Identify the term being asked by the statement: a. It describes mRNA that results in a single translation of several genes at a time. b. It guides the newly formed polypeptide/protein to the endoplasmic reticulum for further processing c. These are Nucleotide sequences resulting in stem loop structures in the mRNA , and subsequent falling off of the RNA polymerase from the mRNA strand. d. It is a A secondary structure in proteins where the amino acid chains aligned side-by-side with every other chain situated opposite the other, with chains being held together by hydrogen bonds
Evaluate the following statements. Which one statement is false? a. The active form of prokaryotic RNA polymerase is a haloenzyme. b. Anti-codons are a nucleotide triplet in transfer RNA that are complementary and antiparallel to the codons of messenger RNA c. During translation, the terminal carboxyl group of an existing peptide will form a peptide bond with the next amino acid in sequence. d. The amino acid R-group is necessary for the formation of tertiary and quaternary structures through covalent bonds, ionic bonds, hydrogen bonds, and hydrophobic interactions. e. The sigma factors of prokaryotes are responsible for binding a DNA promotor sequence so translation can begin. f. The terminal carboxyl and terminal amino groups of amino acids within a peptide are necessary for the formation of secondary structures through hydrogen bonds. g. A restriction enzyme can target supercoiled, relaxed, or linearized plasmid DNA. h.…
Date: Class: Name: RNA Modification Questions Answer the following questions. 1. What is the initial transcript called? 2. What is the final messenger MRNA called? 3. What two things are added to the messenger RNA? 4. What fragments are removed from the messenger RNA? 5. Why are the poly A tail and methyl G cap important? 6. Below, on the left, are the sequences of 3 pre-mRNAs. The exons are underlined and the introns are not underlined. Draw the mature mRNA's (ready to leave the nucleus) below each pre-mRNA. a. AUGGGGCCCAAACCCCAGUUUUAA b. AUGCAGUUGUUACGCCAAGGCCCGCGCGAUAG c. AUGUCAUGUAUCAUGUAUGUAUGUAUGUAUGUAGUAUGUAGUAUGUUUGUAUAAA (C) 2015 Bethany Lau.