6. In the following graph, the dashed line shows the level of mRNA for a certain protein, Prot6, at various positions along the anterior-posterior axis of an insect embryo. The solid lines portray the levels of two regulatory proteins, A and B, that control translation of the Prot6 mRNA. В Position Biology: How Life Works, Second Edition © 2016 W.H. Freeman and Company If both A and B stimulate translation of the Prot6 mRNA, then which graph, from the ones shown below, best approximates the expected level of Prot6 across the embryo? Briefly justify your answer. M K Q rotein level MRNA level

6. In the following graph, the dashed line shows the level of mRNA for a certain protein, Prot6, at various positions along the anterior-posterior axis of an insect embryo. The solid lines portray the levels of two regulatory proteins, A and B, that control translation of the Prot6 mRNA. В Position Biology: How Life Works, Second Edition © 2016 W.H. Freeman and Company If both A and B stimulate translation of the Prot6 mRNA, then which graph, from the ones shown below, best approximates the expected level of Prot6 across the embryo? Briefly justify your answer. M K Q rotein level MRNA level

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter15: From Dna To Protein

Section: Chapter Questions

Problem 5TYK: Which of the following statements is false? a. GTP is an energy source during various stages of...

See similar textbooks

Similar questions

4. In the graph shown below, the dashed line shows the level of MRNA for a certain protein, Prot6, at various positions along the anterior-posterior axis of an insect embryo. The solid lines portray the levels o two regulatory proteins, A and B that control translation of the Prot6 mRNA. A B Position Biology: How Life Works, Second Edition © 2016 W.H. Freeman and Company If both A and B stimulate translation of the Prot6 mRNA, then which graph, from the ones shown below, best approximates the expected level of Prot6 across the embryo? Briefly justify your answer. M H K Position Position Position Position Position Protein level MRNA level
2. Shown below is the DNA sequence of a eukaryotic gene that encodes a short peptide. The sequence of the final processed mRNA synthesized from this gene is given below. Genomic DNA sequence: 5'-AGCTCATGTGCGAGTCCTGACGCTGACTAGG-3' 3'-TCGAGTACACGCTCAGGACTGCGACTGATCC-5' Processed mRNA sequence: 5'-G*UCAUGUGCGAACGCUGACUAGGAAAAAAAA....-3' In the genomic DNA sequence shown above, draw a box around each of the two exons in the gene or write the two exon sequences. а. b. In the processed mRNA above, some nucleotides are present that are not coded for in the genomic DNA sequence. Name the two processes that have occurred to add these nucleotides to the mRNA.
3. Transcribe the following DNA sequences into their corresponding mRNA. (Hint: be sure to pay attention to the 5' and 3' ends!) 3' GGCTTATACGGGCCAAACGTGCATATTGC 5' a) Gene: Matching mRNA 5' 5' TGAACATGGGCAGGTTGACTCGGATCATG 3' b) Gene: Matching mRNA 5' 3' 3'
. One mechanism by which antisense RNAs act as negative regulators of gene expression is by base pairingwith the ribosome binding site on the sense mRNA toblock translation. In a second, alternative mechanism,the act of transcribing an antisense RNA can somehow prevent RNA polymerase from recognizing thesense promoter for the same gene. Design an experimental approach that would enable you to distinguishbetween these two modes of action at a specific gene.(Hint: What would be the outcome in each case ifhigh levels of the antisense RNA were transcribedfrom a gene on a plasmid?)
Which of the following statements is false? a. GTP is an energy source during various stages of translation. b. In the ribosome, peptidyl transferase catalyzes peptide bondformation between amino acids. c. When the mRNA code UAA reaches the ribosome, there isno tRNA to bind to it. d. A long polypeptide is cut off the tRNA in the A site so its Metamino acid links to the amino acid in the P site. e. Forty-two amino acids of a protein are encoded by 126nucleotides of the mRNA.
A part of an mRNA molecule with the sequence 5-UGC GCA-3 is being translated by a ribosome. The following activated tRNA molecules are available. tRNA Anticodon Amino Acid 3-GGC-5 Proline 3-CGU-5 Alanine 3-UGC-5 Treonine 3-CCG-5 Glycine 3-ACG-5 Cysteine 3-CGC-5 Alanine Which two of them can bind correctly to the mRNA so that a dipeptide can form? a. cysteinealanine b. prolinecysteine c. glycinecysteine d. alaninealanine e. threonineglycine
1. Describe which enzymes are required for lactose and tryptophan metabolism in bacteria when lactose and tryptophan, respectively, are (a) present and (b) absent. 2. Contrast positive versus negative regulation of gene expression. Describe the role of the repressor in an inducible system and in a repressible system.
1. How would the following affect BOTH transcription and translation of a particular multi- exon gene in a eukaryotic cell (for each address both transcription and translation of a particular multi-exan gene; also treat each independently): A mutation abolishing kinase activity in TFIIH a. b. A mutation abolishing mRNA binding in the snRNP U1 С. A mutation in aminoacyl tRNA synthetase for isoleucine such that it can't bind ATP (assume there is an isoleucine in the code)
2. Consider the pre-mRNA molecule shown below. Re-order the events listed, in the sequence they would occur during pre-mRNA processing in eukaryotes. Pre-MRNA Exon 1 Intron Exon 2 Pre-MRNA processing MRNA Exon1 Exon 2 AAAAA 3 Export to cytoplasm Translation Recognition and binding the 3' AAUAAA sequence by specific proteins Attachment of snRNP U1 to the 5' splice site Formation of a bond between the guanine in the 5' splice site and the adenine of the branch point Binding of the snRNP U4, U5 and U6 complex to the spliceosome Addition of the 5' cap Release of the intron as a lariat structure and splicing of exon 1 and 2 Addition of the poly(A) tail Binding of snRNP U2 to the branch point Cleavage at the poly (A) site
6. A portion of a gene is shown below. 5'-ATGATTCGCCTCGGGGCTCCCCAGTCGCTGGTGCTGCTGACGCTGCTCGTCG-3' 3'-TACTAAGCGGAGCCCCGAGGGGTCAGCGACCACGACGACTGCGACGAGCAGC-5' The sequence of the mRNA transcribed from this gene has the following sequence: 5'-AUGAUUCGCCUCGGGGCUCCCCAGUCGCUGGUGCUGCUGACGCUGCUCGUCG-3′ a. Identify the coding and noncoding strands of the DNA. b. Explain why only the coding strands of DNA are commonly published in databanks.
4e. You also study the expression of 3 different mutants for this gene. For each mutant answer the following: Does this mutation change the sequence of the protein produced? Why or why not? If it does change the sequence of protein be sure to write out the new sequence. If it does not change the protein sequence, what effect (if any) would you expect it to have on expression of the gene? 1 20 ORI 40 60 5..ТТCGAGCTСТСGТCGTCGAGATACGCGATGATATTACTGGTААТАТGGGGATGCАСТАТС..3' 3'...AAGCTCGAGAGCAGCAGCTCTАTGCGСТАСТАТААТGACCATTATAССССТАСGTGATAG..5' * promoter i. Mutant A has a single base pair substitution with the T/A being replaced with C/G base pair at position 35 (position denoted by the * in the sequence above). ii. Mutant B has a 2 G/C pairs inserted between position 19 and 20 (position denoted by the ^ in the sequence above).
Match the following list of RNAs (left side) with their function(s) (right side).w. mRNA i. block translation of elected mRNAsx. rRNA ii. modification and processing of rRNAy. snoRNA iii. modification of snoRNA and snRNAz. snRNA iv. components of ribosomeaa. tRNA v. spilicing of RNA transcriptsbb. scaRNA vi. directs degradation of selected mRNAscc. miRNA vii. codes for proteinsdd. siRNA viii. adaptor for protein synthesis