WHAT IF? In Figure 18.17b, the lower cell is synthesizingsignaling molecules, whereas the upper cell is expressingreceptors for these molecules. In terms of gene regulationand cytoplasmic determinants, explain how these cellscame to synthesize different molecules.
Q: regulation of gene expression.
A: Operon is operating units which can be defined as the cluster of genes located together on the…
Q: MAKE CONNECTIONS How is ligand binding similarto the process of allosteric regulation of…
A: Ligands are the molecules that bind to a receptor and change the confirmation of the receptor. It…
Q: 1. Read the FRQ prompt below: Solid tumors are clusters of cancer cells and often contain blood…
A: Signal transduction is a series of cellular and molecular events through which a physical or…
Q: SCIENTIFIC INQUIRY You hope to study a gene that codes fora neurotransmitter protein produced in…
A: Hello. Since your question has multiple sub-parts, we will solve first three sub-parts for you. If…
Q: . MAKE CONNECTIONS The p53 protein can activategenes involved in apoptosis. Review Concept 11.5,…
A: Cells are exposed to exogenous and endogenous compounds which cause DNA damage. It results in…
Q: 1. You are stuaying regulation of peri gene expi amounts of Per1 mRNA and protein in normal cells…
A: PER1 transcription is regulated by protein interactions with its five E-box and one D-box elements…
Q: WHAT IF? The researchers needed further evidence, so they injectedbicoid mRNA into the anterior end…
A: Bicoid is a morphogen. It stimulates the development of anterior structures by binding to regulatory…
Q: WHAT IF? Suppose the mRNA being degraded in Figure18.14 coded for a protein that promotes cell…
A: Gene regulation involves the expression of certain genes at a time out of all the genes present in…
Q: EVOLUTION CONNECTION Identify the evolutionarymechanisms that might account for the origin…
A: The cell-to-cell signaling in prokaryotes worked for their self-defense, locations, adaptations, and…
Q: Q7: Which of the following is a function of a membrane protein! 0 Signal transduction O Transport O…
A: Membrane protein - These are those proteins present on the surface of membrane. It is of three types…
Q: WHAT IF? Imagine a protein that functions in the ERbut requires modification in the Golgi apparatus…
A: Protein formation is the common term for translation which is the last step of the central dogma of…
Q: MAKE CONNECTIONSPDGF signals cells by binding toa cell-surface receptor tyrosinekinase. If you added…
A: Receptor tyrosine kinases (RTKs) are cell surface receptors that are dimers. they have a…
Q: WHAT IF? If a plant has the double mutation ctr andein, what is its triple-response phenotype?…
A: Mutation is defined as sudden inheritable change that occurs in the DNA sequence. Mutation occurs…
Q: Q.Consider this problem: You are working in the lab to study the pattern of paralysis and candidate…
A: 5'- GTA GCA TTT AAG CTT CAG TCC AAG - 3' met thr phe glu ile gln ser…
Q: WHAT IF? If you were a pharmaceutical researcher, whywould you want to learn the three-dimensional…
A: Pharmaceutical researchers want to try to treat diseases by learning how to change signalling…
Q: . Explain the process of transcription in cells?
A: The central dogma of molecular biology, given by Dr. Francis Crick states that the information…
Q: WHAT IF? Suppose that instead of the PBDG receptor, the researchers hadused a receptor specific for…
A: Sensory system is a part of nervous system. It helps the animal to interact with the stimuli and…
Q: Describe the 4 different types of stem cells. (Totipotent, pluripotent, multipotent, IPS)
A: Stem cells are partially differentiated or completely undifferentiated cells which have the…
Q: Practice ques tion 1B) Mutations in the signalling pathways depicte d above have been associated…
A: Drug that inhibits microtubule assembly will inhibit mitosis and consequently mitosis. So, this drug…
Q: e important functions of apopt
A: Apoptosis is a common process through which programmed cell death takes place. There are two forms…
Q: Why have cellular biochemical signalling pathways evolved?
A: Cellular biochemical signaling is the process by which a signal activates the receptor which is…
Q: Suppose you discovered protein X that functions in the ER. You then discovered that protein X…
A: Introduction : mRNA is formed form DNA by transcription process into the cell nucleus. Then mRNA…
Q: WHAT IF? Patients with diseases such as heart disease or Alzheimer’scould have their own skin cells…
A: Step 1 Induced pluripotent stem cells is a kind of pluripotent cell that can be made from adult…
Q: WHAT IF? A certain mutation in E. coli changes the lacoperator so that the active repressor cannot…
A: Step 1 Lactose Operon (Inducible Operon System) is a regulated operon system in which the structural…
Q: The inner cell mass in a blastocyst is pluripotent. Pluripotency means that each one of the cells is…
A: Embryonic stem cells (ESCs) ae pluripotent stem cells derived from the undifferentiated inner mass…
Q: 2. Which of the following can result in cell migration at the end point of signal transduction? O…
A: cell migration is the movements of cells in a directed manner either by : chemical signals…
Q: Review how the signal-recognition particle (SRP) and SRP receptor guide proteins containing an ER…
A: The signal recognition particle (SRP) is an abundant, cytosolic, uniformly preserved…
Q: How apoptotic pathway can be exploited to treat various cancers?
A: Apoptosis is a series of processes occurring one after the other which results in the death of a…
Q: What are carrier proteins? Explain it's types with examples
A: Introduction: A membrane transport protein is a protein that moves ions, small molecules, and…
Q: Which of the following statement is correct regarding cells? a. Two choices are correct b. Cells…
A: Cells are the smallest unit of life. Cells consists of cytoplasm enclosed within membrane. The cells…
Q: Think about the types of cellular processes that occur within the nucleus of a cell and the types of…
A: The nuclear chamber is defined by the nuclear envelope, which encloses the DNA. Nuclear pore…
Q: ) Describe the role of the signal sequence and the signal recognition particle (SRP) in targeting…
A: Every cells provide a set of separate segments for localization of proteins. The method of…
Q: WHAT IF? If apoptosis occurred when it should not,what types of protein defects might be the cause?…
A: The cells, which undergo any type of infection, are damaged. The cells that are at the end of their…
Q: MAKE CONNECTIONS Evaluate whether the originof cell-to-cell attachment proteins in animals…
A: Descent with modification means the characteristics are passed from generation to generation. It…
Q: MAKE CONNECTIONS Explain how receptor tyrosinekinases and intracellular receptors might functionin…
A: Cell division is the process by which a parent cell divides into two or more daughter cells. It…
Q: Q. Describe the different methods the cells use to restrict proteins to specific regions of the…
A: Biological membranes are divided into specific functional areas with distinct compositions that can…
Q: what is cell signaling?
A: Cell is the functional and strutural unit of life . Cells make up tissues and tissues make up organs…
Q: Listen 96 73 Membranes and the Export of Proteins Key Idea: The synthesis, packaging and movement of…
A: Endomembrane system: - it is a system through which the cell modify, package and transport the…
Q: WHAT IF? If two cells have different scaffolding proteins,explain how they might behave differently…
A: Scaffold proteins are modular proteins that assemble multimolecular complexes or macromolecular…
Q: Give a detailed description of how the protein(KRAS) encoded for by your protein normally functions…
A: Thank you for the question Answer :- The KRAS gene gives instructions for creating a protein called…
Q: Match the components involved with ER transport with their initial appropriate cellular location;…
A: To identify: To identify and match the components involved with ER transport with their given…
Q: Ligands are extracellular proteins involved in signalling. Explain how a typical ligand is secreted…
A: Communication between cells takes place through chemical signals. These chemical signals called…
Q: Q How can quorum sensing be considered a regulatorymechanism for conserving cell resources?
A: Quorum sensing (QS) is the bacterial communication system that uses ‘inducers’ as the signalling…
Q: WHAT IF? Some human diseases are associated withmalfunctioning protein phosphatases. How would…
A: Protein phosphatases are the enzymes that are involved in removing phosphate group from the…
Q: Cells use different mechanisms to sense and respond to changes in intracellular versus extracellular…
A: Cells behave differently to extracellular changes such as temperature, pH, or nutrients. Cells works…
Q: What if? If apoptosis occurred when it should not, what types of protein defects might be the
A: Apoptosis : It means programmed cell death. It is characterized by a series of typical…
Q: Stem cells: Describe the 4 different types of stem cells. (Totipotent, pluripotent,
A: Stem cells are the self renewing population of cells which divide to give rise to a stem cell and a…
WHAT IF? In Figure 18.17b, the lower cell is synthesizing
signaling molecules, whereas the upper cell is expressing
receptors for these molecules. In terms of gene regulation
and cytoplasmic determinants, explain how these cells
came to synthesize different molecules.
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- WRITE ABOUT A THEME: ORGANIZATION The properties oflife emerge at the biological level of the cell. The highly regulated process of apoptosis is not simply the destruction of acell; it is also an emergent property. Write a short essay (about100–150 words) that briefly explains the role of apoptosis inthe development and proper functioning of an animal, and describe how this form of programmed cell death is a process thatemerges from the orderly integration of signaling pathways.Or. Foyez Samar The volume enclosed by the plasma membrane of plant cells is often much larger the c corresponding volume in animal cells. The most regsengble explanation for this observation Is that A) plant cells are capable of having a much higher surface-to-volume ratio than animal cells. B) plant cells have a much more highly convoluted (folded) plasma membrane than animal cens. C) plant cells contain a large vacuole that reduces the volume of the cytoplasm. D) animal cells are more spherical, whereas plant cells are elongated. 12 A uO Search View Help Grammarly Describe in detail each of the following proteins and their role in the cellular processes that they are involved. How does the structure of each relate to their specific function? i) Ras ii) immunoglobulins iii) CDKS
- See figure 12.16b regarding the process by which cyclin regulates the Cdk. Suppose that the cyclin binding site in the Cdk contains these FOUR amino acids in this order from top to bottom: serine, lysine, aspartic acid acid and lysine and the Cdk binding site in the cyclin contains these FOUR amino acids in this order from top to bottom: aspartic acid, aspartic acid, lysine and serine. Use the schematics below to show the R groups and how they might interact to create the cyclin.cdk complex. Label both binding sites, show all charges that will be used to create any bonds, and label all bonds formed and add the ATP active site. Cyclin Serine Lysine Aspartic "Acid Lysine -OH NH3t -Coo NH3+ NH3 + -OH Aspartic Aad Aspartic Acid /Lysine Serine сокSee figure 12.16b regarding the process by which cyclin regulates the Cdk. Suppose that the cyclin binding site in the Cdk contains these FOUR amino acids in this order from top to bottom: serine, lysine, aspartic acid acid and lysine and the Cdk binding site in the cyclin contains these FOUR amino acids in this order from top to bottom: aspartic acid, aspartic acid, lysine and serine. Use the schematics below to show the R groups and how they might interact to create the cyclin.cdk complex. Label both binding sites, show all charges that will be used to create any bonds, and label all bonds formed and add the ATP active site. A Explain what a kinase does and how the cyclin controls the activity of the Cdk.What property prevents the ligands of cell-surface receptors from entering the cell? The molecules bind to the extracellular domain. The molecules are hydrophilic and cannot penetrate the hydrophobic inferior of the plasma membrane. The molecules are attached to transport proteins that deliver them through the bloodstream to target cells. The ligands are able to penetrate the membrane and directly influence gene expression upon receptor binding.
- In 2005, Frederick Blattner and his colleagues foundthat E. coli cells have a global transcriptional programthat helps them forage for better sources of carbon. Many genes, including genes needed for bacterial motility, are turned on in response to poorer carbonsources so that the bacteria can search for better nutrition. You now want to search for genes that regulatethis response. How could you use lacZ fusions to tryto identify such regulatory genes?You study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. MRNA 1 20 ORI 40 60 ТТCGAGCTCTСGTCGTCGAGATACGCGATGATATTАСТGGТААТАТСGGGАTGCАСТАТС 3' 5' AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCATTATAÇECCTACGTGATAG ΤΑTC promoter RNA polymerase Practice Question 4 C) What are the first 5 amino acids encoded by this gene? N' C' ribosomeYou study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. MRNA 1 20 ORI 40 60 TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAA! AAGCTCGAGAGCAGCAGCTСТАTGCGCTAСТАТААТGACСАТТАТАССССТАСGTGATAG 3' СTGGIAATATOGGGATGCACTАТС 5' RNA promoter polymerase Practice Question 4 F) You also study the expression of different mutants for this gene. Mutant B has a 2 G/C pairs inserted between position 19 and 20 (position denoted by the ^ in the sequence above). For mutant B answer the following: Does this mutation change the sequence of the protein produced? Why or why not? If it does change the sequence of protein be sure to write out the new sequence. If it does not change the protein sequence, what effect (if any) would you expect it to have on expression of the gene? 1 20 ORI 40 60 3'...TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC...5' 5'..AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCATTATACCCCTACGTGATAG...3' promoter m in…
- Q: Ligands are extracellular proteins involved in signalling. Explain how a typical ligand is secreted starting from the time the ribosome starts translating the mRNA of the gene encoding the ligand. ** THE ANSWER SHOULD NOT EXPLAIN THE MECHANISM OF TRANSLATION **You study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. MRNA 20 ORI 40 60 3' ТТCGAGCTCTCСТCGTCGAGATACGCGAT SCGATGATATTAC: ТАСTGGTAATАTоGGGATGCACTAТС AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCANTATAÇCCCTACGTGATAG ΤΑTC 5' promoter RNA polymerase Practice Question 4 B) What is the sequence of the first 10 nucleotides of the transcript of this gene? 5' 3' ribosomeBriefly explain in your words the role of how Inside-out signaling of integrin occurs?