Foundations in Microbiology
10th Edition
ISBN: 9781259705212
Author: Kathleen Park Talaro, Barry Chess Instructor
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 9.1, Problem 1CYP
1. Compare the genetic material of eukaryotes, bacteria, and viruses in terms of general structure, size, and mode of replication.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
10. Replication is the flow of information from:
a) DNAàDNA
b) DNAà mRNA
c) mRNAà polypeptide
d) polypeptideà amino acids
25. A bacteriophage virus infects a bacterial cell, causing the cell's own chromosomal DNA to
become fragmented. One of the new bacteriophage viruses being assembled in the cell
accidentally scoops up some of the bacterium's chromosomal DNA. This bacteriophage virus
goes on to infect a new bacterium. When it does so, it inserts DNA from the previous cell into
the new cell. That DNA becomes integrated into the new cell's genome. This gene transfer
process between bacteria is referred to as:
A: Transformation
OB: Transduction
O C: Transcription
OD: Conjugation
1. List the complementary non-coding DNA sequence.
CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCCC . . .
Chapter 9 Solutions
Foundations in Microbiology
Ch. 9.1 - 1. Define heredity, genetics, genome, gene,...Ch. 9.1 - 2. Compare the basic nature of genetic material in...Ch. 9.1 - 3. Explain how DNA is organized and packaged.Ch. 9.1 - 4. Describe the chemical structure of DNA and Its...Ch. 9.1 - Prob. 5ELOCh. 9.1 - 6. Describe the process of DNA replication as it...Ch. 9.1 - 1. Compare the genetic material of eukaryotes,...Ch. 9.1 - 2. Characterize the organization of genetic...Ch. 9.1 - Prob. 3CYPCh. 9.1 - 4. What are the fundamental building blocks of DNA...
Ch. 9.1 - 5. Describe what is meant by the antiparallel...Ch. 9.1 - 6. Explain the synthesis of the leading and...Ch. 9.1 - 7. Name several characteristics of DNA structure...Ch. 9.2 - Prob. 7ELOCh. 9.2 - Prob. 8ELOCh. 9.2 - 9. Describe the different types of RNA and their...Ch. 9.2 - Prob. 10ELOCh. 9.2 - 11. Describe the genetic code, codons, and...Ch. 9.2 - 12. Recount the participants and steps in...Ch. 9.2 - Prob. 13ELOCh. 9.2 - 8. How is the language of a gene expressed?Ch. 9.2 - Prob. 9CYPCh. 9.2 - 10. Construct a table that compares the structure...Ch. 9.2 - Prob. 11CYPCh. 9.2 - Prob. 12CYPCh. 9.2 - Prob. 13CYPCh. 9.2 - Prob. 14CYPCh. 9.2 - 15. Briefly describe the events in translation.Ch. 9.2 - Prob. 16CYPCh. 9.2 - 17. Summarize how bacterial and eukaryotic cells...Ch. 9.2 - Prob. 18CYPCh. 9.3 - 14. Explain the functions of operons in bacterial...Ch. 9.3 - 15. Describe the main features of the lactose...Ch. 9.3 - 16. Describe the main features of repressible...Ch. 9.3 - 17. Summarize some aspects of genetic control by...Ch. 9.3 - 19. What is an operon? Describe the functions of...Ch. 9.3 - 20. Compare and contrast the lac operon and...Ch. 9.3 - Prob. 21CYPCh. 9.3 - 22. At which levels of DNA regulation do small...Ch. 9.4 - Prob. 18ELOCh. 9.4 - Summarize the causes and types of mutations and...Ch. 9.4 - Prob. 20ELOCh. 9.4 - Compare beneficial and detrimental effects of...Ch. 9.4 - Explain what is meant by the terms mutation and...Ch. 9.4 - Describe the primary causes, types, and outcomes...Ch. 9.4 - Explain the purposes behind replica plating and...Ch. 9.5 - Explain recombination in bacteria and what it...Ch. 9.5 - Describe the main features of conjugation and its...Ch. 9.5 - Prob. 24ELOCh. 9.5 - Identify the basic processes involved in...Ch. 9.5 - Discuss transposons and their importance to...Ch. 9.5 - Compare conjugation, transformation, and...Ch. 9.5 - Explain the differences between general and...Ch. 9.5 - By means of a flowchart, show the possible jumps...Ch. 9.6 - Explain the major elements of viral genetics.Ch. 9.6 - Compare aspects of the genetics of DNA and RNA...Ch. 9.6 - Explain why some viruses must enter the nucleus to...Ch. 9.6 - Explain the difference between positive-strand and...Ch. 9.6 - Outline the basic steps in the replication cycles...Ch. 9.L1 - What is the smallest unit of heredity (genotype)?...Ch. 9.L1 - Prob. 2MCQCh. 9.L1 - The nitrogen bases in DNA are bonded to the a....Ch. 9.L1 - DNA replication is considered semiconservative...Ch. 9.L1 - In DNA, adenine is the complementary base for...Ch. 9.L1 - The base pairs are held together primarily by a....Ch. 9.L1 - Why must the lagging strand of DNA be replicated...Ch. 9.L1 - Messenger RNA is formed by _______ of a gene on...Ch. 9.L1 - Prob. 9MCQCh. 9.L1 - Prob. 10MCQCh. 9.L1 - Prob. 11MCQCh. 9.L1 - Prob. 12MCQCh. 9.L1 - Prob. 13MCQCh. 9.L1 - Prob. 14MCQCh. 9.L1 - Which genetic material could be transmitted...Ch. 9.L1 - Prob. 16MCQCh. 9.L1 - Which of the following is present in prokaryotes...Ch. 9.L1 - Multiple Matching. Fill in the blanks with all the...Ch. 9.L1 - Prob. 1CSRCh. 9.L1 - Prob. 2CSRCh. 9.L1 - Explain how it would be possible for A. baumannii...Ch. 9.L1 - Prob. 1WCCh. 9.L1 - Prob. 2WCCh. 9.L1 - The following sequence represents triplets on DNA:...Ch. 9.L1 - Describe the actions οf all of the enzymes...Ch. 9.L1 - Prob. 5WCCh. 9.L1 - Examine the following series of words and identify...Ch. 9.L2 - Knowing that retroviruses operate on the principle...Ch. 9.L2 - Using the piece of DNA in writing-challenge...Ch. 9.L2 - Why will a mistake in the RNA code alone not...Ch. 9.L2 - The enzymes required to carry out transcription...Ch. 9.L2 - Prob. 5CTCh. 9.L2 - Activation, transcription, and translation of the...Ch. 9.L2 - Explain the mechanisms by which RNA can control...Ch. 9.L2 - Ex�Ιain how epigenetics is related to the...Ch. 9.L2 - Use the concepts of chapters, letters, a whole...Ch. 9.L2 - From figure 9.17, step 3. Label each part of the...Ch. 9.L2 - Examine figure 8.11, and explain which type of...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- 4. It is known that RNA is a nucleic acid responsible for the synthesis of proteins. However, there is another nucleic acid alongside RNA: DNA. What role does the latter play in relation to RNA? a) RNA is synthesized in the cell in case too large a mutation damages the DNA. b) DNA has the reproductive genetic code of all cells and passes it on to RNA. c) DNA directs the synthesis of enzymes, while RNA synthesizes proteins. d) DNA synthesizes RNA according to a blueprint that includes the guidelines necessary for the structure of proteins.arrow_forward2. List the DNA strand sequence complementary to the template strand. CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCCC . . .arrow_forward20. Describe three types of DNA repair that can occur in the cell. Name the three types and briefly describe why they are different.arrow_forward
- 1) Translate a mRNA sequence into a protein sequence using the genetic code. 2) write the complementary base pairs for a single strand of DNA.arrow_forward26. In some cases involying bacteriophages, the viral DNA will insert itself into the bacterial DNA. Which of the following statements does not correctly describe this type of insertion? A) The inserted viral DNA is referred to as a prophage. B) The inserted viral DNA can leave the bacterial DNA. C) The inserted viral DNA is a part of the lysogenic cycle of replication. D) The inserted viral DNA can never leave the bacterial DNA and enter the lytic cycle.arrow_forwardCompare the genetic material of eukaryotes, bacteria, and viruses in terms of general structure, size, and mode of replication.arrow_forward
- 7. In terms of organism, location and function, what are the major differences between nuclear and plasmid DNA? Briefly discuss what happens during transcription and translation.arrow_forward5. In the replication of a DNA molecule, two daughter molecules, S and T, are formed. The following base sequence is part of the "parent" strand in daughter molecule S: 5' TTCAGAG 3'. Indicate the corresponding base sequence in a) The newly formed strand in daughter molecule T. b) The newly formed strand in daughter molecule S. c) The "parent" strand in daughter molecule T.arrow_forward5. Bacteriophages' genomes are typically composed of A) double-stranded DNA. B) double-stranded RNA. C) single-stranded RNA. D) single-stranded DNA.arrow_forward
- 1. Describe and list the steps involved in DNA replication. 2. Create a timeline of transcribing events. 3. Outline the steps of the translation process. 4. Describe the mechanism of action of antibiotics that target the protein synthesis process.arrow_forward1. Distinguish DNA and RNA according to their structure and functions.arrow_forward7. An original strand of DNA has the following sequence of nucleotides: NNNNONNNNNNINN CC AT CTGGA ACACTACTTAA AATAACA nnnnnnOnNnNNnnnnnn UUUDOUUUUUUUUUUUUUUUUUUUU Fill in the corresponding nucleotides for the RNA strand.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY