The duplicate of the given DNA molecule. The direction of replication and what causes the leading and lagging strands to replicate differently. How this is semiconservative replication and whether the new strands are identical to the old ones. Introduction: Replication of DNA involves the retention of one of the old strands in each new molecule of DNA. It occurs because the DNA strands follow base-complementarity rules.

Question

1. On a piece of paper, replicate the following segment of DNA: 5’ ATCGGCTACGTTCAC 3’ 3’ TAGCCGATGCAAGTG 5’ a.) show the direction of replication of the new strands and explain what the lagging and leading strands are. b) Explain how this is semiconservative replication. Are the new strands identical to the original segment of DNA? 2. Createyour own an Illustration of the Central Dogma. Provide your own DNA segment. Use the previous topics as reference.

Answer 1

Question

Definition Definition Chemical process in which one or more monomers combine to produce a very large chain-like molecule called a polymer. The functional groups present on the monomers and their steric effects are responsible for polymerization through a sequence of reactions that vary in complexity. There exists a stable covalent chemical bond between monomers that sets apart polymerization from other processes.

Chapter 9.L1, Problem 2WC

Summary Introduction

To determine:

The duplicate of the given DNA molecule.

The direction of replication and what causes the leading and lagging strands to replicate differently.

How this is semiconservative replication and whether the new strands are identical to the old ones.

Introduction:

Replication of DNA involves the retention of one of the old strands in each new molecule of DNA. It occurs because the DNA strands follow base-complementarity rules.

Expert Solution & Answer

Trending nowThis is a popular solution!

See solution

Check out sample textbook solution

Students have asked these similar questions

1. On a piece of paper, replicate the following segment of DNA: 5’ ATCGGCTACGTTCAC 3’ 3’ TAGCCGATGCAAGTG 5’ a.) show the direction of replication of the new strands and explain what the lagging and leading strands are. b) Explain how this is semiconservative replication. Are the new strands identical to the original segment of DNA? 2. Createyour own an Illustration of the Central Dogma. Provide your own DNA segment. Use the previous topics as reference.

1c) During DNA replication, both positive and negative supercoiling is introduced in the DNA being replicated. Name the enzymes that introduce supercoiling into DNA during replication; please clearly indicate which enzyme(s) introduce positive supercoiling and which enzyme(s) introduce negative supercoiling.

Take each of the DNA sequences and complete ALL of the following steps: i. Find the DNA Replication Complement of each strand ii. Transcribe the complement strand of DNA into an mRNA strand Translate the mRNA strand into an Amino Acid strand iii. a. ATGGACGTATAGATGACAGGTAGATGTTTCAGGGGGATTTATCGATAG b. ATGGCCATTGAGTGTCAAAAGTCTCAATGA First base U UUU UUC UUA UUG CUU CUC C CUA CUG G U -phenylalanine (Phe) -leucine (Leu) GUU GUC GUA GUG leucine (Leu) AUU AUC isoleucine (lle) Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Second base ACU ACC AUA ACA AUG methionine (Met) (start) ACG -valine (Val) UCU UCC UCA UCG CCU CCC CCA CCG GCU GCC GCA GCG C -serine (Ser) -proline (Pro) -threonine (Thr) -alanine (Ala) UAU UAC UAA stop UAG stop CAU CAC CAA CAG AAU AAC AAA AAG A -tyrosine (Tyr) GAU GAC GAA GAG - histidine (His) -glutamine (Gln) - asparagine (Asn) -lysine (Lys) -aspartic acid (Asp) -glutamic acid (Glu) CGU CGC CGA CGG AGU AGC AGA AGG G -cysteine…

Answer 2

Question

Definition Definition Chemical process in which one or more monomers combine to produce a very large chain-like molecule called a polymer. The functional groups present on the monomers and their steric effects are responsible for polymerization through a sequence of reactions that vary in complexity. There exists a stable covalent chemical bond between monomers that sets apart polymerization from other processes.

Chapter 9.L1, Problem 2WC

Summary Introduction

To determine:

The duplicate of the given DNA molecule.

The direction of replication and what causes the leading and lagging strands to replicate differently.

How this is semiconservative replication and whether the new strands are identical to the old ones.

Introduction:

Replication of DNA involves the retention of one of the old strands in each new molecule of DNA. It occurs because the DNA strands follow base-complementarity rules.

Expert Solution & Answer

Trending nowThis is a popular solution!

See solution

Check out sample textbook solution

Answer 3

Question

Definition Definition Chemical process in which one or more monomers combine to produce a very large chain-like molecule called a polymer. The functional groups present on the monomers and their steric effects are responsible for polymerization through a sequence of reactions that vary in complexity. There exists a stable covalent chemical bond between monomers that sets apart polymerization from other processes.

Chapter 9.L1, Problem 2WC

Summary Introduction

To determine:

The duplicate of the given DNA molecule.

The direction of replication and what causes the leading and lagging strands to replicate differently.

How this is semiconservative replication and whether the new strands are identical to the old ones.

Introduction:

Replication of DNA involves the retention of one of the old strands in each new molecule of DNA. It occurs because the DNA strands follow base-complementarity rules.

Expert Solution & Answer

Trending nowThis is a popular solution!

See solution

Check out sample textbook solution

Answer 4

Question

Definition Definition Chemical process in which one or more monomers combine to produce a very large chain-like molecule called a polymer. The functional groups present on the monomers and their steric effects are responsible for polymerization through a sequence of reactions that vary in complexity. There exists a stable covalent chemical bond between monomers that sets apart polymerization from other processes.

Chapter 9.L1, Problem 2WC

Summary Introduction