Foundations in Microbiology
10th Edition
ISBN: 9781259705212
Author: Kathleen Park Talaro, Barry Chess Instructor
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 9.2, Problem 17CYP
17. Summarize how bacterial and eukaryotic cells differ in gene structure, transcription, and translation.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
3. Draw and Describe the DNA of prokaryotic and eukaryotic cells. Give their differences.
11. Transcription is the flow of information from:
a) DNAàDNA
b) DNAà mRNA
c) mRNAà polypeptide
d) polypeptideà amino acids
4. It is known that RNA is a nucleic acid responsible for the synthesis of proteins. However, there is another nucleic acid alongside RNA: DNA. What role does the latter play in relation to RNA?
a) RNA is synthesized in the cell in case too large a mutation damages the DNA.
b) DNA has the reproductive genetic code of all cells and passes it on to RNA.
c) DNA directs the synthesis of enzymes, while RNA synthesizes proteins.
d) DNA synthesizes RNA according to a blueprint that includes the guidelines necessary for the structure of proteins.
Chapter 9 Solutions
Foundations in Microbiology
Ch. 9.1 - 1. Define heredity, genetics, genome, gene,...Ch. 9.1 - 2. Compare the basic nature of genetic material in...Ch. 9.1 - 3. Explain how DNA is organized and packaged.Ch. 9.1 - 4. Describe the chemical structure of DNA and Its...Ch. 9.1 - Prob. 5ELOCh. 9.1 - 6. Describe the process of DNA replication as it...Ch. 9.1 - 1. Compare the genetic material of eukaryotes,...Ch. 9.1 - 2. Characterize the organization of genetic...Ch. 9.1 - Prob. 3CYPCh. 9.1 - 4. What are the fundamental building blocks of DNA...
Ch. 9.1 - 5. Describe what is meant by the antiparallel...Ch. 9.1 - 6. Explain the synthesis of the leading and...Ch. 9.1 - 7. Name several characteristics of DNA structure...Ch. 9.2 - Prob. 7ELOCh. 9.2 - Prob. 8ELOCh. 9.2 - 9. Describe the different types of RNA and their...Ch. 9.2 - Prob. 10ELOCh. 9.2 - 11. Describe the genetic code, codons, and...Ch. 9.2 - 12. Recount the participants and steps in...Ch. 9.2 - Prob. 13ELOCh. 9.2 - 8. How is the language of a gene expressed?Ch. 9.2 - Prob. 9CYPCh. 9.2 - 10. Construct a table that compares the structure...Ch. 9.2 - Prob. 11CYPCh. 9.2 - Prob. 12CYPCh. 9.2 - Prob. 13CYPCh. 9.2 - Prob. 14CYPCh. 9.2 - 15. Briefly describe the events in translation.Ch. 9.2 - Prob. 16CYPCh. 9.2 - 17. Summarize how bacterial and eukaryotic cells...Ch. 9.2 - Prob. 18CYPCh. 9.3 - 14. Explain the functions of operons in bacterial...Ch. 9.3 - 15. Describe the main features of the lactose...Ch. 9.3 - 16. Describe the main features of repressible...Ch. 9.3 - 17. Summarize some aspects of genetic control by...Ch. 9.3 - 19. What is an operon? Describe the functions of...Ch. 9.3 - 20. Compare and contrast the lac operon and...Ch. 9.3 - Prob. 21CYPCh. 9.3 - 22. At which levels of DNA regulation do small...Ch. 9.4 - Prob. 18ELOCh. 9.4 - Summarize the causes and types of mutations and...Ch. 9.4 - Prob. 20ELOCh. 9.4 - Compare beneficial and detrimental effects of...Ch. 9.4 - Explain what is meant by the terms mutation and...Ch. 9.4 - Describe the primary causes, types, and outcomes...Ch. 9.4 - Explain the purposes behind replica plating and...Ch. 9.5 - Explain recombination in bacteria and what it...Ch. 9.5 - Describe the main features of conjugation and its...Ch. 9.5 - Prob. 24ELOCh. 9.5 - Identify the basic processes involved in...Ch. 9.5 - Discuss transposons and their importance to...Ch. 9.5 - Compare conjugation, transformation, and...Ch. 9.5 - Explain the differences between general and...Ch. 9.5 - By means of a flowchart, show the possible jumps...Ch. 9.6 - Explain the major elements of viral genetics.Ch. 9.6 - Compare aspects of the genetics of DNA and RNA...Ch. 9.6 - Explain why some viruses must enter the nucleus to...Ch. 9.6 - Explain the difference between positive-strand and...Ch. 9.6 - Outline the basic steps in the replication cycles...Ch. 9.L1 - What is the smallest unit of heredity (genotype)?...Ch. 9.L1 - Prob. 2MCQCh. 9.L1 - The nitrogen bases in DNA are bonded to the a....Ch. 9.L1 - DNA replication is considered semiconservative...Ch. 9.L1 - In DNA, adenine is the complementary base for...Ch. 9.L1 - The base pairs are held together primarily by a....Ch. 9.L1 - Why must the lagging strand of DNA be replicated...Ch. 9.L1 - Messenger RNA is formed by _______ of a gene on...Ch. 9.L1 - Prob. 9MCQCh. 9.L1 - Prob. 10MCQCh. 9.L1 - Prob. 11MCQCh. 9.L1 - Prob. 12MCQCh. 9.L1 - Prob. 13MCQCh. 9.L1 - Prob. 14MCQCh. 9.L1 - Which genetic material could be transmitted...Ch. 9.L1 - Prob. 16MCQCh. 9.L1 - Which of the following is present in prokaryotes...Ch. 9.L1 - Multiple Matching. Fill in the blanks with all the...Ch. 9.L1 - Prob. 1CSRCh. 9.L1 - Prob. 2CSRCh. 9.L1 - Explain how it would be possible for A. baumannii...Ch. 9.L1 - Prob. 1WCCh. 9.L1 - Prob. 2WCCh. 9.L1 - The following sequence represents triplets on DNA:...Ch. 9.L1 - Describe the actions οf all of the enzymes...Ch. 9.L1 - Prob. 5WCCh. 9.L1 - Examine the following series of words and identify...Ch. 9.L2 - Knowing that retroviruses operate on the principle...Ch. 9.L2 - Using the piece of DNA in writing-challenge...Ch. 9.L2 - Why will a mistake in the RNA code alone not...Ch. 9.L2 - The enzymes required to carry out transcription...Ch. 9.L2 - Prob. 5CTCh. 9.L2 - Activation, transcription, and translation of the...Ch. 9.L2 - Explain the mechanisms by which RNA can control...Ch. 9.L2 - Ex�Ιain how epigenetics is related to the...Ch. 9.L2 - Use the concepts of chapters, letters, a whole...Ch. 9.L2 - From figure 9.17, step 3. Label each part of the...Ch. 9.L2 - Examine figure 8.11, and explain which type of...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- 1. Discuss the structure and functions of the prokaryotic structures covered in class: cell wall, plasma membrane, cytoplasm, genetic material, glycocalyx, flagella, fimbriae, pili, ribosome, endospore. 2. Compare prokaryotic and eukaryotic cell types and at least 4 differences between the two. 3. Compare the structures of gram positive and gram negative cells. 4. Compare the appearance and functions of the major cellular structures of eukaryotic and prokaryotic cells. Identify the 4 major organic molecules found in all living cells. Identify the 2 major components found in the plasma membrane. Diagram and describe the phospholipids molecule, including the 2 parts of the structure, which is polar and non-polar, and which is hydrophobic and hydrophilic. Identify and describe the 2 types of proteins found in the plasma membrane and their function. Describe what is required for a molecule to cross the plasma membrane to get in or out of the cell. 5. 6. 7. 8. 9. 10. Identify the three…arrow_forward20. Three structures are represented in the diagram below. Cell DNA Protein What is the relationship between these three structures? The cell is composed only of DNA and protein. DNA controls the production of protein in the cell. ODNA is made up of proteins that are synthesized in the cell. O Protein is composed of DNA that is stored in the cell.arrow_forwardSummarize how bacterial and eukaryotic cells differ in gene structure,transcription, and translation.arrow_forward
- Using examples, explain how biology can be studied from a microscopic approach to a global approach.arrow_forward21.An RNA or DNA molecule is a polymer made of subunits called 22.Which of the following is NOT needed for protein synthesis a, tRNA b, spindle fibers c, enzymes d, ribosomes 23. What does DNA do inside the cell? it destroys incorrect nucleotides in the nucleus it maintains the integrity of the nuclear membrane It prevents the excess buildup of nucleotide bases it directs the synthesis of proteins 24. What is a genome? Group of answer choices The complete collection of an organisms genetic information The combination of proteins and DNA found in the sex cells All the genes found in a population The number of chromosomes found in each cellarrow_forward18. Which of the following is a major difference between eukaryotic and prokaryotic cells? A) eukaryotic cells contain a nucleus, prokaryotic cells do not B) eukaryotic cells contain organelles, prokaryotic cells do not C) eukaryotic cells are much larger than prokaryotic cells D) eukaryotic cells often form multicellular organisms, prokaryotic cells do not E) all of the abovearrow_forward
- 9. Translation is the flow of information from: a) DNAàDNA b) DNAà mRNA c) mRNAà polypeptide d) polypeptideà amino acidsarrow_forward16. The steps (and in the correct order )that must occur for proteins to be made are: Group of answer choices translate the gene, transport the gene translate the gene, transport the gene copy the gene, transport the gene, translate the gene transport the gene, copy the gene, translate the genearrow_forward8) Which of the following best describes why it is possible for the bacteria to read the instructions in a human gene and produce a human protein as a result? Bacterial cells and human cells are identical and contain the same organelles Bacterial cells and human cells both use DNA to store their genetic information The genetic code is universal - the same codon codes for the same amino acid in all species The bacterial cell already contains a gene that is very similar to the human growth hormone genearrow_forward
- Place the following structures in order from least to most complex organization: chromatin, nucleosome, DNA, chromosome DNA, nucleosome, chromatin, chromosome nucleosome, DNA, chromosome, chromatin DNA, chromatin, nucleosome, chromosome nucleosome, chromatin, DNA, chromosomearrow_forward6. Examine the following coding strand DNA nucleotide sequence,^representing the complete gene sequence (i.e. control elements + RNA-coding sequence) of a bacterial gene. Answer the questions below by using the list of consensus sequences and the genetic code. 5' CGCTCAGAAAATTATATTAAATTTCCTCTTGACACTCGCTTTCGTGATCGTCTTATAATGTGTGGATG CCGAAAACGACAATTTCTGACTTACCGGGGTTTTAAGGAGGTAATATGCAAATTAGCGATACCGGCC GCAGCCACACTCCTGACTTTCACGCCTAGTCGCCCGTGAAGACTGGCACAACCAGACCATTACCCACC TTAACCGCCTGCCAGCGCATCCCGTTTTCGCCAGCTGGCGCGATGAGCTTGCCGCCCGCGATTCAGCC CGCGTAGTAAGCGGGCTTTTTTTGGGAGTGGCAGTTCTCTTACGCCCGCAGCCCG 3' Clearly indicate the following directly on the DNA sequence above: promoter elements - underline and label as (a). the sites for initiation of transcription - use an arrow V and label as (b). the sites for termination of transcription – use an V arrow and label as (c). d. Give the sequence of the first 10 nucleotides of the mRNA transcript 5' to 3'. a. b. С.arrow_forward1. Define a chromosome, gene and DNA? 2. Discuss gene expression from transcription to translation.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningAnatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax College
- Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License