It is known that RNA is a nucleic acid responsible for the synthesis of proteins. However, there is another nucleic acid alongside RNA: DNA. What role does the latter play in relation to RNA? a) RNA is synthesized in the cell in case too large a mutation damages the DNA. b) DNA has the reproductive genetic code of all cells and passes it on to RNA. c) DNA directs the synthesis of enzymes, while RNA synthesizes proteins. d) DNA synthesizes RNA according to a blueprint that includes the guidelines necessary for the structure of proteins.

Q: What molecule catalyzes the formation of proteins

A: The protein synthesis process is a process where amino acids are formed by reading the frame of the…

Q: 26. In some cases involving bacteriophages, the viral DNA will insert itself into the bacterial DNA.…

A: A bacteriophage is a bacteria-infecting virus. A bacteriophage is a virus that is made up of DNA or…

Q: Bacterial DNA has how many origins of replication? A) 0 B) 1 C) 10 D) depends on the size of…

A: Two identical copies of a DNA molecule are produced by DNA replication. This is important for cell…

Q: A large portion of the human genome is transposons. Collectively, they are most likely: A) an equal…

A: Transposons also known as transposable elements or jumping genes are sequences of DNA that have the…

Q: The RNA complement of a protein coding gene is what? A) mRNA B) rRNA C) snRNA D) tRNA

A: Explanation: The mRNA specifies, in triplet code, the amino acid sequence of proteins

Q: The process shown here is a) Replication b) Splicing c) Translation d) Transcription

A: The Central Dogma theory states that "DNA makes DNA through Replication, DNA makes RNA through…

Q: Translation is the flow of information from: a) DNAàDNA b) DNAà mRNA c) mRNAà polypeptide d)…

A: Introduction  Genome consists of DNA/RNA which consists of nucleotides either deoxyribose…

Q: Which of the following point mutations is likely to be the worst for an organism if they happened in…

A: Mutation is a change in genetic sequence or genomic sequence of an organism. This change can be…

Q: How can a person's muscle cells have the same exact DNA sequences as their nerve cells even though…

A: DNA Sequencing : it is a laboratory technique used to determine the exact sequence of bases(A,C,G…

Q: 14. What is an anticodon? a. The three tRNA bases that pair with a specific amino acid. b. The three…

A: What is anticodon? Option b. The three tRNA bases that pair with a specific codon in an mRNA.

Q: Which of the following processes is a part of protein synthesis and is NOT affected by a silent…

A: Introduction DNA is a self replicating molecule. During DNA replication each strand of DNA acts as a…

Q: If a DNA sequence (exons and introns) and the regions upstream/downstream are normal -- but no mRNA…

A: During RNA splicing Introns are removed and Exons ligated together to give rise to a functional RNA…

Q: An anticodon is 5' CGA 3'. The codon that pairs with the anticodon will be a) 3'UGC5' b) 5'GCT3' c)…

A: Transcription: "It is the process through which the enzyme RNA Polymerase transfers information from…

Q: The map of the chromosome which shows identifiable sites is called___________a) Gene expressionb)…

A: Chromosomes can be defined as thread-like structures where the DNA remains tightly packed within the…

Q: 5) Which mutation would NOT cause a change in an organism's phenotype?   A) TAT becomes TGT     B)…

A: The amino acids coded are decided by the sequence of the DNA, as the template strand is transcribed…

Q: In the replication of a DNA molecule, two daughter molecules, Q and R, are formed. The following…

A: DNA replication is a biochemical process in which DNA molecules produce duplicate molecules of…

Q: For many years, scientist believed that proteins were the source of heritable information. There are…

A:

Q: What is an open-reading frame? a) An unknown gene b) The protein-encoding sequence of a gene c) A…

A: ORFs are commonly found within genes, which are segments of DNA that contain the instructions for…

Q: What is the first genetic material? A) M-DNA B) R-DNA. C) RNA.

A:

Q: The flow of genetic information usually takes place from a) RNA to DNA to proteins b) proteins to…

A: In most organisms, genetic information is in the form of deoxy ribonucleic acid (DNA), while in some…

Q: How do cells use genetic instructions to form the shape of something as complex as the human nose?

A: Introduction  The life starts from single cell called Zygote. A zygote is formed by the fusion of…

Q: The extra chromosomal, self-replicating, closed, double stranded and circular DNA molecule is…

A: In biotechnology vectors are DNA molecules which carry a foreign DNA fragment when inserted into…

Q: You extract all nucleic acids from a culture of yeast cells into a test tube. You are provided with…

A: Nucleic acids are biological macromolecules that store and transmit genetic information in living…

Q: 16) Mutations that occur during the process of DNA replication: Answer: A) almost always lead to…

A: Not all mutation results in genetic disorder. Most of the mutation have no impact on health of a…

Q: G10

A: The question is asking to determine the number of exons in a gene if it is known that the gene has…

Q: 48. Which of the following is a definition of messenger RNA (mRNA)? a. RNA found in the ribosome,…

A: RNA stands for Ribonucleic Acid. It is the product of transcription. There are various RNA namely,…

Q: The regulation of most bacterial genes occurs at the level of (a) transcription (b) translation (c)…

A: Genes are collections of nucleotides that code for a specific protein. For protein synthesis to…

Q: The transmission of information is from DNA to RNA to proteins. Would it not be more efficient for…

A: The central dogma states that the DNA can replicate to form another DNA i.e. from parent to daughter…

Q: Some flatworms can regrown body parts when injured. In the lab, you can sever the tail or head off…

A: The ability of an organism to regenerate amputated body parts is known as regeneration. There are…

Q: Identify 5 common characteristics of transcription and replication

A: Transcription is a process in which the information in the template strand of a DNA is copied into a…

Q: The function of mRNA is to (a) deliver amino acids to the ribosome             (b)  act as the…

A: The DNA (deoxyribonucleic acid) is the genetic material of an organism. The DNA is inherited by the…

Q: 1. Below is a sequence of DNA bases. =T ACTTCACG AGTGAGACT a) Transcribe to MRNA: AUGAAGUGCUCACUCUGA…

A: Transcription is a process in which the DNA sequence is converted to mRNA. In mRMA there is Uracil…

Q: RNA can function:   please explain your answer  a.A) as a non-permanent template to synthesize…

A: All of the above

Q: 1. Using the DNA provided transcribe DNA into MRNA. 2. Use the mRNA strand you created and break it…

A: # According to our guideline we can answer maximum three sub parts of a questions. So, upload the…

Q: Can you please answer 16,17, and 18 please

A: “Since you have asked multiple question, we will solve the first question for you. If you want any…

Q: 5. Which of the following plays a substantial role in linking together sister chromatids immediately…

A: Cohesin holds sister chromatids together until anaphase. anaphase promoting complex which is a…

Q: Which of the following is the primary function of RNA molecule? A) transmit genetic information to…

A:

Q: what features do RNA and DNA have in common? and genes are copied into RNA during what process?

A: DNA stands for deoxyribose Nucleic acid and RNA stand for Ribonucleic acid. DNA have double-helical…

Q: 11. Transcription is the flow of information from: a) DNAàDNA b) DNAà mRNA c) mRNAà polypeptide d)…

A: Gene is the structural and functional unit in the DNA. Genes are composed of nucleotide nitrogenous…

Q: List the complementary non-coding DNA sequence. CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCCC . . .

A: DNA consist of a double-helical structure where one strand is called a sense strand or non-coding…

Q: The codon on the ________ matches with the anticodon on the ________ to direct the addition of the…

A: Codon are the triple of a base pair.

Q: The advantage of yeast cells over bacterial cells to express human proteins is that: a. yeast cells…

A: DNA (deoxyribonucleic acid) is the genetic material in most organisms. Recombinant DNA (rDNA)…

Viral Replication

The virus is acellular and considered non-living outside the host cell. The replication of the virus occurs only inside the living cells. Only a few genes are present in the smallest virus, whereas many genes are present in the largest virus. These genes encode specific viral proteins.