Foundations in Microbiology
10th Edition
ISBN: 9781259705212
Author: Kathleen Park Talaro, Barry Chess Instructor
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 9.3, Problem 21CYP
Summary Introduction
To determine:
A diagram for figures 9.20 and 9.21, indicating the reverse of events.
Introduction:
Figures 9.20 and 9.21 represent the lac operon (inducible operon) and the arg operon (repressible operon). A diagram for the reverse of events in these operons must indicate the return of the operons to their respective normal conditions.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Explain the role of the araC and CAP proteins in the regulation of the ara operon under the following conditions:
2.1.1 High glucose and no arabinose in the medium.
2.1.2 No glucose and arabinose as the sole
35. The genes shown are from the lac operon system of E.coli. The symbols a, b and c represent the repressor (I) gene, the operator (O) region, and the structural gene (Z) for β-galactosidase, although not in that order. Furthermore, the symbols written in the genotypes are not necessarily the actual sequence in the lac operon.
1.
The following are genotypes of merozygotes of E. coli with various combinations of lac operon mutations. Determine the phenotype with respect to beta-galactosidase (z), permease (y), and trans-acetylase (a) of each combination as U = uninducible, I = inducible, and C = constitutive. Choose from the following answers. i- p+ o+ z+ y- a+ / i+ p+ oc z- y- a+
Answer choices
UII
UIC
UUU
ICC
CUC
IUC
CCU
2.
The following are genotypes of merozygotes of E. coli with various combinations of lac operon mutations. Determine the phenotype with respect to beta-galactosidase (z), permease (y), and trans-acetylase (a) of each combination as U = uninducible, I = inducible, and C = constitutive. Choose from the following answers. i- p+ o+ z- y+ a+ / iS p+ o+ z- y+ a+
Answer choices
ICC
CCU
UII
IUC
UIC
CUC
UUU
Chapter 9 Solutions
Foundations in Microbiology
Ch. 9.1 - 1. Define heredity, genetics, genome, gene,...Ch. 9.1 - 2. Compare the basic nature of genetic material in...Ch. 9.1 - 3. Explain how DNA is organized and packaged.Ch. 9.1 - 4. Describe the chemical structure of DNA and Its...Ch. 9.1 - Prob. 5ELOCh. 9.1 - 6. Describe the process of DNA replication as it...Ch. 9.1 - 1. Compare the genetic material of eukaryotes,...Ch. 9.1 - 2. Characterize the organization of genetic...Ch. 9.1 - Prob. 3CYPCh. 9.1 - 4. What are the fundamental building blocks of DNA...
Ch. 9.1 - 5. Describe what is meant by the antiparallel...Ch. 9.1 - 6. Explain the synthesis of the leading and...Ch. 9.1 - 7. Name several characteristics of DNA structure...Ch. 9.2 - Prob. 7ELOCh. 9.2 - Prob. 8ELOCh. 9.2 - 9. Describe the different types of RNA and their...Ch. 9.2 - Prob. 10ELOCh. 9.2 - 11. Describe the genetic code, codons, and...Ch. 9.2 - 12. Recount the participants and steps in...Ch. 9.2 - Prob. 13ELOCh. 9.2 - 8. How is the language of a gene expressed?Ch. 9.2 - Prob. 9CYPCh. 9.2 - 10. Construct a table that compares the structure...Ch. 9.2 - Prob. 11CYPCh. 9.2 - Prob. 12CYPCh. 9.2 - Prob. 13CYPCh. 9.2 - Prob. 14CYPCh. 9.2 - 15. Briefly describe the events in translation.Ch. 9.2 - Prob. 16CYPCh. 9.2 - 17. Summarize how bacterial and eukaryotic cells...Ch. 9.2 - Prob. 18CYPCh. 9.3 - 14. Explain the functions of operons in bacterial...Ch. 9.3 - 15. Describe the main features of the lactose...Ch. 9.3 - 16. Describe the main features of repressible...Ch. 9.3 - 17. Summarize some aspects of genetic control by...Ch. 9.3 - 19. What is an operon? Describe the functions of...Ch. 9.3 - 20. Compare and contrast the lac operon and...Ch. 9.3 - Prob. 21CYPCh. 9.3 - 22. At which levels of DNA regulation do small...Ch. 9.4 - Prob. 18ELOCh. 9.4 - Summarize the causes and types of mutations and...Ch. 9.4 - Prob. 20ELOCh. 9.4 - Compare beneficial and detrimental effects of...Ch. 9.4 - Explain what is meant by the terms mutation and...Ch. 9.4 - Describe the primary causes, types, and outcomes...Ch. 9.4 - Explain the purposes behind replica plating and...Ch. 9.5 - Explain recombination in bacteria and what it...Ch. 9.5 - Describe the main features of conjugation and its...Ch. 9.5 - Prob. 24ELOCh. 9.5 - Identify the basic processes involved in...Ch. 9.5 - Discuss transposons and their importance to...Ch. 9.5 - Compare conjugation, transformation, and...Ch. 9.5 - Explain the differences between general and...Ch. 9.5 - By means of a flowchart, show the possible jumps...Ch. 9.6 - Explain the major elements of viral genetics.Ch. 9.6 - Compare aspects of the genetics of DNA and RNA...Ch. 9.6 - Explain why some viruses must enter the nucleus to...Ch. 9.6 - Explain the difference between positive-strand and...Ch. 9.6 - Outline the basic steps in the replication cycles...Ch. 9.L1 - What is the smallest unit of heredity (genotype)?...Ch. 9.L1 - Prob. 2MCQCh. 9.L1 - The nitrogen bases in DNA are bonded to the a....Ch. 9.L1 - DNA replication is considered semiconservative...Ch. 9.L1 - In DNA, adenine is the complementary base for...Ch. 9.L1 - The base pairs are held together primarily by a....Ch. 9.L1 - Why must the lagging strand of DNA be replicated...Ch. 9.L1 - Messenger RNA is formed by _______ of a gene on...Ch. 9.L1 - Prob. 9MCQCh. 9.L1 - Prob. 10MCQCh. 9.L1 - Prob. 11MCQCh. 9.L1 - Prob. 12MCQCh. 9.L1 - Prob. 13MCQCh. 9.L1 - Prob. 14MCQCh. 9.L1 - Which genetic material could be transmitted...Ch. 9.L1 - Prob. 16MCQCh. 9.L1 - Which of the following is present in prokaryotes...Ch. 9.L1 - Multiple Matching. Fill in the blanks with all the...Ch. 9.L1 - Prob. 1CSRCh. 9.L1 - Prob. 2CSRCh. 9.L1 - Explain how it would be possible for A. baumannii...Ch. 9.L1 - Prob. 1WCCh. 9.L1 - Prob. 2WCCh. 9.L1 - The following sequence represents triplets on DNA:...Ch. 9.L1 - Describe the actions οf all of the enzymes...Ch. 9.L1 - Prob. 5WCCh. 9.L1 - Examine the following series of words and identify...Ch. 9.L2 - Knowing that retroviruses operate on the principle...Ch. 9.L2 - Using the piece of DNA in writing-challenge...Ch. 9.L2 - Why will a mistake in the RNA code alone not...Ch. 9.L2 - The enzymes required to carry out transcription...Ch. 9.L2 - Prob. 5CTCh. 9.L2 - Activation, transcription, and translation of the...Ch. 9.L2 - Explain the mechanisms by which RNA can control...Ch. 9.L2 - Ex�Ιain how epigenetics is related to the...Ch. 9.L2 - Use the concepts of chapters, letters, a whole...Ch. 9.L2 - From figure 9.17, step 3. Label each part of the...Ch. 9.L2 - Examine figure 8.11, and explain which type of...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Explain why (a) inactivation of the O2 or O3 sequence of the lac operon causes only a twofold loss in repression, and (b) inactivation of both O2 and O3 reduces repression ∼70-fold.arrow_forward127. Whicn of the following statement concerning the regulator gene (i) associated with the lac operon is correct ? (1) MRNA is transcribed from the i-gene whether lactose is present or not. (2) MRNA is transcribed from the i-gene only when lactose is not present (3) Lactose inhibit the synthesis of mRNA from i-gene (4) Lactose promotes the synthesis of mRNA from i-genearrow_forwardGive all possible genotypes of a lac operon that produces, or fails to produce, β-galactosidase and permease under the following conditions. Do not give partial-diploid genotypes. Lactose absent Lactose present β-Galactosidase Permease β-Galactosidase Permease a. − − + + b. − − − + c. − − + − d. + + + + e. − − − − f. + − + − g. − + − +arrow_forward
- Suppose you have six strains of E. coli. One is wildtype, and each of the other five has a single one of thefollowing mutations: lacZ−, lacY−, lacI−, oc, andlacIS. For each of these six strains, describe thephenotype you would observe using the following assays. [Notes: (1) IPTG is a colorless synthetic molecule that acts as an inducer of lac operon expressionbut cannot serve as a carbon source for bacterialgrowth because it cannot be cleaved byβ-galactosidase; (2) X-gal cannot serve as a carbonsource for growth; (3) E. coli requires active lactosepermease (the product of lacY) to allow lactose,X-gal, or IPTG into the cells.] Colony color in medium containing glycerol as theonly carbon source and X-gal, but no IPTG.d. Colony color in medium containing high levels ofglucose as the only carbon source, X-gal, andIPTG.e. Colony color in medium containing high levels ofglucose as the only carbon source and X-gal, butno IPTGarrow_forward7.17 Contrast the regulation of an inducible operon with that of a repressible operon, and give an example of each.arrow_forwardThe streptolysin S toxin made by S. pyogenes is encoded by a 9-gene operon, sagABCDEFGHI. Thinking about what a 3-line diagram would look like for this operon, answer the following questions. Write numeric answers only. For example, if your answer is 6 promoters, write only 6. 1) How many promoters control the expression of these genes? 2) How many locations does RNA Polymerase bind to get full expression of these genes? 3) How many ribosome binding sites are needed for full protein expression? 4) How many start codons will be needed for full protein expression? 5) How many mRNA strands will be produced with full operon expression? 6) How many proteins will be produced with full protein expression? 1arrow_forward
- Which of the following lac operon genotypes would allow for functional versions of all the structural enzymes of the lac operon to be expressed constitutively even in the absence of lactose? Group of answer choices I+ O+ Z+ Y+ A+ I- O+ Z- Y- A- I+ OC Z+ Y+ A+ IS O+ Z+ Y+ A+ I+ O+ Z- Y+ A+arrow_forward. a. How many ribosomes are required (at a minimum)for the translation of trpE and trpC from a singletranscript of the trp operon?b. How would you expect deletion of the two tryptophan codons in the RNA leader to affect theexpression of the trpE and trpC genes?arrow_forwardThe following is a sequence of the leader region ofthe his operon mRNA in Salmonella typhimurium.What bases in this sequence could cause a ribosometo pause when histidine is limiting (that is, when thereis very little of it) in the medium?5′ AUGACACGCGUUCAAUUUAAACACCACCAUCAUCACCAUCAUCCUGACUAGUCUUUCAGGC 3′arrow_forward
- 2) Attenuation of the trp operon is controlled by the formation of stem-loop structures in the mRNA of the trpl region. The attenuation function can be disrupted by mutations that alter the sequence of the repeat DNA regions 1-4 and prevent formation of the RNA stem loops. Describe the most likely effects on attenuation of each of the following mutation under the conditions specified. a. Mutation in region 1 and low levels of tryptophan: b. Mutation in region 2 and low levels of tryptophan: Mutation in region 2 and moderate levels of tryptophan (low enough to release the repression but enough to allow the ribosome to NOT pause): с. d. Mutation in region 3 and low levels of tryptophan: е. Mutation in region 3 and moderate levels of tryptophan (low enough to release the repression but enough to allow the ribosome to NOT pause): f. Mutation in region 4 and low levels of tryptophan:arrow_forwardLike the lac operon, the hexose operon is controlled by a separate regulatory protein under the control of its own promoter (see the schematic of the operon below). The hexose regulatory protein is sensitive to fatty acyl CoA levels. When all hexose fuel sources are depleted, the bacteria switch to lipid metabolism and fatty acyl CoA levels increase. This turns expression of the hexose operon off. +1 +1 Regulatory Gene Pregulator P operon Hexose Operon Genes regulator promoter operon promoterarrow_forwardThe lac genotypes are as shown below: P+OcZ-Y+A+// P¯O+Z+Y+A+ (i) The lac operon consists of three structural genes, lacZ, lacY and lacA. Which structural genes are involved in lactose metabolism? Explain. (ii) Draw and explain how lactose repress the gene expression in lac IS/I- heterozygote. (iii) What is the function of the promoter in the bacterial operon?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY