Foundations in Microbiology
10th Edition
ISBN: 9781259705212
Author: Kathleen Park Talaro, Barry Chess Instructor
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 9.2, Problem 9CYP
Summary Introduction
To determine:
The length of a bacterial gene sequence that codes for a protein having 3,300 amino acids.
Introduction:
An amino acid is coded for by a set of three nucleotides.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
1. The nontemplate strand of a segment of double-
helical DNA contains the sequence:
(5')CGCTATAGCGTTTAG (3') (a) What is the MRNA
base sequence that can be transcribed from this
double helical DNA assuming you already have a ready
RNA polymerase present and everything else needed
for RNA transcription? Label the sequence ends and list
what is required for RNA Pol to work. (b) What amino
acid sequence could be coded by the mRNA in (a)'s
answer assuming the AUG start codon is just upstream
of the MRNA (not shown in the sequence provided)?
Use table in Figure 27-7 of the Lehninger 7 th ed
"Dictionary of amino acid code words in mRNAs" and
write the peptide according to standard convention
with abbreviations for the amino acids. (c) If the wrong
strand was transcribed and then translated from the
section of double stranded DNA shown above, what
would the resulting amino acid sequence be? What
would the MRNA sequence be? Explain your answer
and label all strands.
歐歐队
相阳阳一即即的 9
First letter…
30 A DNA sequence encoding a five-amino acid polypeptide is given below.
…ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT…
…TGCCGTTCTAGGGTGGGATTAGTCTGGCATGGTAAGTGGAGGA…
a)Locate the sequence encoding the five amino acids of the polypeptide, and identify the template and coding strand.
(a) Write the DNA double strand.
(b) Assuming the gel pattern represents the template strand, transcribe and
translate the DNA.
(c) Write the anticodon sequence.
A
G
2nd (middle) Base of a Codon
1*
3rd
U
A
G
Base
Base
UUU - Phe
U
UUC - Phe
UCU - Ser
UCC - Ser
UAU - Tyr
UAC - Tyr
UGU - Cys
UGC - Cys
UUA - Leu
UCA- Ser
UAA - STOP
UGA - STOP
UUG -Leu
CUU - Leu
CUC - Leu
UCG-Ser
CCU - Pro
CCC- Pro
UAG- STOP
CAU - His
САC - His
UGG- Trp
CGU - Arg
CGC - Arg
CGA - Arg
CGG- Arg
CỦA - Leu
ССА-Pro
CAA - Gin
CAG- Gin
AAU - Asn
CUG - Leu
CCG-Pro
AUU - Ile
ACU - Thr
АCC - Th
ACA - Thr
AGU – Ser
A
AGC - Ser
AGA - Arg
AGG - Arg
GGU - Gly
GGC - Gly
GGA - Gly
GGG - Gly
AUC - lle
AAC - Asn
AAA - Lys
AAG - Lys
GAU - Asp
GAC - Asp
GAA - Glu
AUA- lle
AUG - Met
ACG - Thr
G
GUU - Val
GCU - Ala
GCC - Ala
GUC - Val
GUA- Val
GCA - Ala
GUG - Val
GCG - Ala
GAG - Glu
PUAGPCAGUCACUCAG
|
Chapter 9 Solutions
Foundations in Microbiology
Ch. 9.1 - 1. Define heredity, genetics, genome, gene,...Ch. 9.1 - 2. Compare the basic nature of genetic material in...Ch. 9.1 - 3. Explain how DNA is organized and packaged.Ch. 9.1 - 4. Describe the chemical structure of DNA and Its...Ch. 9.1 - Prob. 5ELOCh. 9.1 - 6. Describe the process of DNA replication as it...Ch. 9.1 - 1. Compare the genetic material of eukaryotes,...Ch. 9.1 - 2. Characterize the organization of genetic...Ch. 9.1 - Prob. 3CYPCh. 9.1 - 4. What are the fundamental building blocks of DNA...
Ch. 9.1 - 5. Describe what is meant by the antiparallel...Ch. 9.1 - 6. Explain the synthesis of the leading and...Ch. 9.1 - 7. Name several characteristics of DNA structure...Ch. 9.2 - Prob. 7ELOCh. 9.2 - Prob. 8ELOCh. 9.2 - 9. Describe the different types of RNA and their...Ch. 9.2 - Prob. 10ELOCh. 9.2 - 11. Describe the genetic code, codons, and...Ch. 9.2 - 12. Recount the participants and steps in...Ch. 9.2 - Prob. 13ELOCh. 9.2 - 8. How is the language of a gene expressed?Ch. 9.2 - Prob. 9CYPCh. 9.2 - 10. Construct a table that compares the structure...Ch. 9.2 - Prob. 11CYPCh. 9.2 - Prob. 12CYPCh. 9.2 - Prob. 13CYPCh. 9.2 - Prob. 14CYPCh. 9.2 - 15. Briefly describe the events in translation.Ch. 9.2 - Prob. 16CYPCh. 9.2 - 17. Summarize how bacterial and eukaryotic cells...Ch. 9.2 - Prob. 18CYPCh. 9.3 - 14. Explain the functions of operons in bacterial...Ch. 9.3 - 15. Describe the main features of the lactose...Ch. 9.3 - 16. Describe the main features of repressible...Ch. 9.3 - 17. Summarize some aspects of genetic control by...Ch. 9.3 - 19. What is an operon? Describe the functions of...Ch. 9.3 - 20. Compare and contrast the lac operon and...Ch. 9.3 - Prob. 21CYPCh. 9.3 - 22. At which levels of DNA regulation do small...Ch. 9.4 - Prob. 18ELOCh. 9.4 - Summarize the causes and types of mutations and...Ch. 9.4 - Prob. 20ELOCh. 9.4 - Compare beneficial and detrimental effects of...Ch. 9.4 - Explain what is meant by the terms mutation and...Ch. 9.4 - Describe the primary causes, types, and outcomes...Ch. 9.4 - Explain the purposes behind replica plating and...Ch. 9.5 - Explain recombination in bacteria and what it...Ch. 9.5 - Describe the main features of conjugation and its...Ch. 9.5 - Prob. 24ELOCh. 9.5 - Identify the basic processes involved in...Ch. 9.5 - Discuss transposons and their importance to...Ch. 9.5 - Compare conjugation, transformation, and...Ch. 9.5 - Explain the differences between general and...Ch. 9.5 - By means of a flowchart, show the possible jumps...Ch. 9.6 - Explain the major elements of viral genetics.Ch. 9.6 - Compare aspects of the genetics of DNA and RNA...Ch. 9.6 - Explain why some viruses must enter the nucleus to...Ch. 9.6 - Explain the difference between positive-strand and...Ch. 9.6 - Outline the basic steps in the replication cycles...Ch. 9.L1 - What is the smallest unit of heredity (genotype)?...Ch. 9.L1 - Prob. 2MCQCh. 9.L1 - The nitrogen bases in DNA are bonded to the a....Ch. 9.L1 - DNA replication is considered semiconservative...Ch. 9.L1 - In DNA, adenine is the complementary base for...Ch. 9.L1 - The base pairs are held together primarily by a....Ch. 9.L1 - Why must the lagging strand of DNA be replicated...Ch. 9.L1 - Messenger RNA is formed by _______ of a gene on...Ch. 9.L1 - Prob. 9MCQCh. 9.L1 - Prob. 10MCQCh. 9.L1 - Prob. 11MCQCh. 9.L1 - Prob. 12MCQCh. 9.L1 - Prob. 13MCQCh. 9.L1 - Prob. 14MCQCh. 9.L1 - Which genetic material could be transmitted...Ch. 9.L1 - Prob. 16MCQCh. 9.L1 - Which of the following is present in prokaryotes...Ch. 9.L1 - Multiple Matching. Fill in the blanks with all the...Ch. 9.L1 - Prob. 1CSRCh. 9.L1 - Prob. 2CSRCh. 9.L1 - Explain how it would be possible for A. baumannii...Ch. 9.L1 - Prob. 1WCCh. 9.L1 - Prob. 2WCCh. 9.L1 - The following sequence represents triplets on DNA:...Ch. 9.L1 - Describe the actions οf all of the enzymes...Ch. 9.L1 - Prob. 5WCCh. 9.L1 - Examine the following series of words and identify...Ch. 9.L2 - Knowing that retroviruses operate on the principle...Ch. 9.L2 - Using the piece of DNA in writing-challenge...Ch. 9.L2 - Why will a mistake in the RNA code alone not...Ch. 9.L2 - The enzymes required to carry out transcription...Ch. 9.L2 - Prob. 5CTCh. 9.L2 - Activation, transcription, and translation of the...Ch. 9.L2 - Explain the mechanisms by which RNA can control...Ch. 9.L2 - Ex�Ιain how epigenetics is related to the...Ch. 9.L2 - Use the concepts of chapters, letters, a whole...Ch. 9.L2 - From figure 9.17, step 3. Label each part of the...Ch. 9.L2 - Examine figure 8.11, and explain which type of...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- How many letters of an RNA molecule, in sequence, does it take to provide the code for a single amino acid? 1 2 3 4arrow_forward4) Consider the following double-stranded DNA molecule: Complementary Strand: ATGTGTAGTGCGAGTTGA Template Strand: TACACATCACGCTCAACT a) What would be the amino acid sequence coded for by the template strand of the DNA molecule above? 7. a) Are codons found in DNA or RNA? b) How many bases are in a codon? c) Give an example of a codon.arrow_forward10. The two strands of DNA that make up the double helix are held to each other by … a) hydrogen bonds between guanine / cytosine, and thymine / adenine. b) hydrophobic bonds between adenine and thymine. c) hydrophobic bonds between guanine / cytosine, and thymine / adenine. d) hydrogen bonds between adenine and cytosine. e) 3′,5′ phosphodiester bonds involving deoxyribose.arrow_forward
- 10. List three examples of stop codons. a) b) c)arrow_forward1. a) If one DNA segment has the following base composition, 5'-CAGTTAGTCA-3', which of the following sequences is complementary? op 1: 3'-CAGTTAGTCA-5' op 2: 3'-TGACTAACTG-5' op 3: 5'-TGACTAACTG-3' op 4: 3'-TGACTAACTG-5' b) What is the nucleotide sequence of the DNA strand that is complementary to 5'-ATCGCAACTGTCACTA-3' op 1: 5'-TAGCGTTGACAGTGATA-3' op 2: 5'-TAGTGACAGTTGCGAT-3' op 3: 5'-ATCACTGTCAACGCTA-3' op 4: 5'-UAGUGACAGUUGCGAU-3'arrow_forwardIf a bacterial protein is 3,300 amino acids long, how many nucleotidepairs long is the gene sequence that codes for it?arrow_forward
- 11) Examine the following two DNA sequences. Sequence 1: ATGCGATGCTAGCAT Sequence 2: ATGCGATGATAGCAT If both of these sequences code for proteins, how might the function of protein 2 differ from the function of protein 1? Use the table below for assistance. U C A G บบน UUC UUA UUG CUU CUC CUA CUG U Phe GUUT GUC GUA GUG Leu Leu AUU AUC lle AUA AUG Met or Start Val Ceweg 232 www... UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG C GCU GCC GCA GCG Ser Pro Thr Ala CAU CAC CAA CAG A AAU AAC AAA AAG UAU U UAC C UAA Stop UGA Stop A UAG Stop UGG Trp G Tyr GAA GAG His Gin Asn Lys GAU GAC Asp G c] Glu UGU UGC CGU CGC CGA CGG AGU AGC AGA AGG GGU GGC GGA GGG Cys Arg Ser Arg Gly U C A G U C A G U C A G by Calin me press A) Protein 1 and protein 2 will function exactly the same. B) Protein 1 will be shorter than protein 2, so they will not function the same. C) Protein 2 will be shorter than protein 1, so they will not function the same. D) Protein 2 has a different sequence, so it will function…arrow_forward7. a) Are codons found in DNA or RNA? b) How many bases are in a codon? c) Give an example of a codon.arrow_forward25. Which sequence includes RNA that's complementary to the DNA sequence 5'-TATTCGC-3'? (Hint: in the DNA/RNA duplex, the strands are anti- parallel.) (a) 5'-AAUAAGCGA-3' (b) 5'-AGCGAAUAA-3' (c) 5'-AUAAGCG-3' (d) none of thesearrow_forward
- 3b) In the real world, where "wobble" pairing is possible, what is the minimum number of tRNAs required to service all of the threonine codons? Write out the base sequences of the anticodons of those tRNAs (remember to label the 5' and 3' end of each anticodon sequence).arrow_forward1) What DNA base sequence is complementary to the following DNA sequence?TAGCGTGCATGGTGCTTAAC2) What RNA base sequence is complementary to the following RNA sequence?UAAUAGCUUGCUGAUarrow_forward5' ACTGAGGATTCGGACAGCAATAGGATG 3' The -2 reading frame of the sequence above gives the following amino acid sequence: ILLLSESS Which DNA codon represents I (isoleucine)? a) 5' TCC 3' b) 5' TAG 3' c) 5' ATC 3' d) 5' CCT 3'arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningAnatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax College
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College
Biology - Intro to Cell Structure - Quick Review!; Author: The Organic Chemistry Tutor;https://www.youtube.com/watch?v=vwAJ8ByQH2U;License: Standard youtube license