7. An original strand of DNA has the following sequence of nucleotides: NNNNONNNNNNINN CC AT CTGGA ACACTACTTAA AATAACA nnnnnnOnNnNNnnnnnn UUUDOUUUUUUUUUUUUUUUUUUUU Fill in the corresponding nucleotides for the RNA strand.

1. Given is a strand of DNA, fill in the corresponding RNA strand and find which amino acids that strand codes for.

If one side of a DNA molecule has the base sequence A T C G G G C C A A C C, what would the sequence be on the complementary strand?

Which of the following statements about the DNA double helix is FALSE? O The base pairs are located in the center of the helix O The plane of the base pairs is perpendicular to the direction of the deoxyribose- phosphate backbone O The two strands have the same 5' to 3' direction (i.e, are parallel) O The base pairs stack on one another O The deoxyribose-phosphate backbone is on the outside of the helix

3. DNA polymerase made a mistake and added a C on the DNA template strand. In the space on the mRNA sequence below, write the added base. (Remember that the DNA template and mRNA are complementary. Mark the codons again and write the amino acid sequence beneath them. What do you observe? (5') CGUUACAAUGUAU CGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA 3' On this mRNA codon table, the first nucleotide in codon is to the left, the second is above, and third is to the right. 4. A mutation in the gene encoding the aminoacyl tRNA synthetase for valine (VAL) causes the tRNA binding site to have the wrong shape. In its new (mutant) shape, the enzyme can bind tRNAs for VAL and leucine (LEU). (not at the same time but enzymes work fast and there are lots of them) a. In cells with this mutant tRNA synthetase, will the protein product of translation match the original one you deduced in question 2? circle one: (YES / NO. ) b. If not, how does it differ? c. How many different version of the short…

1. Using this image of DNA & RNA explain the difference between DNA & RNA NH Thymine Cytosine Adenine Guanine Nucleobases of DNA Base pair Helix of sugar phosphates DNA Deoxyribonucleic acid read and then summarize in YOUR OWN WORDS Nucleobases RNA Ribonucleic Acid NH Uracil Cytosine Adenine Guanine Nucleobases of RNA

The diagram shows a short section of a single strand of DNA. A A ACC T Which strand of DNA will combine with this strand to form part of a double helix? doubxe C T T C L OB O C O D C A CT C T B AAG LL ရွေးချယ်မှုကို ဖယ်ရှားရန် G ၁ မှတ် G G A

Below are DNA strands. Make the complementary DNA strand: Original Strand: 5’ A T G C A A A T T G C T C A C C G G G G A T C A G C A C 3’ Complementary Strand: Original Strand: 3’ A G G G G A T C A G C A C C G G A T T T C A T G A G C C 5’ Complementary Strand: