7. An original strand of DNA has the following sequence of nucleotides: NNNNONNNNNNINN CC AT CTGGA ACACTACTTAA AATAACA nnnnnnOnNnNNnnnnnn UUUDOUUUUUUUUUUUUUUUUUUUU Fill in the corresponding nucleotides for the RNA strand.

7. An original strand of DNA has the following sequence of nucleotides: NNNNONNNNNNINN CC AT CTGGA ACACTACTTAA AATAACA nnnnnnOnNnNNnnnnnn UUUDOUUUUUUUUUUUUUUUUUUUU Fill in the corresponding nucleotides for the RNA strand.

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

13
List the DNA bases that will complementary base pair with the following sequence: A-G-C-T-A-C-G
During DNA replication, a template strand is used to synthesize a new "daughter" strand of DNA. Below is a sequence of a short segment of DNA. Provide the base sequence in the complementary strand and label all ends. 5’ A A T C G T A A G C T 3’
1. Given is a strand of DNA, fill in the corresponding RNA strand and find which amino acids that strand codes for.
If one side of a DNA molecule has the base sequence A T C G G G C C A A C C, what would the sequence be on the complementary strand?
Draw the steps of DNA replication. Use the following nucleotide sequence as reference: 5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’
The template strand of a double helical segment of DNA consists of the following sequence: 5’- GTAGCCTTATCTAGCGATCACCGTCCGTATTACTAGTGGCCAGACTCTTTTCACCATGTATAGTTG-3’ Use the given data to answer the succeeding questions and always indicate (and pay attention to) the DIRECTIONALITY of the strands in your answers. Part I. What is the nucleotide order in the complementary DNA strand? Part 2. What is the nucleotide order in the complementary mRNA that can be transcribed from the given DNA strand? Part 3. What will be the overall anticodon sequence in tRNA? Part 4. Following the transitional process, what is the amino acid sequence that will be coded for? Show your answer using ONE-letter amino code starting from N-terminus to C-terminus Part 5. Following translational process, what is the amino acid sequence that will be coded for? Show your answer using THREE-letter amino acid code starting from N-terminus to C-terminus.
Which of the following statements about the DNA double helix is FALSE? O The base pairs are located in the center of the helix O The plane of the base pairs is perpendicular to the direction of the deoxyribose- phosphate backbone O The two strands have the same 5' to 3' direction (i.e, are parallel) O The base pairs stack on one another O The deoxyribose-phosphate backbone is on the outside of the helix
Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences (all belong to an exon):5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 311. If the above DNA strand is the coding (sense) strand and the DNA molecule is expressed to produce a protein product, however prior to expression, mutation took place where,a. the 15th base was replaced by Guanine. Is the amino acid sequence of the synthesized polypeptide chain altered, as compared when there was no mutation? Specify type of mutation in relation to protein function. Is the base substitution a transition or transversion mutation?b. the 18th base was replaced by Guanine. Is there an effect in the structure and function of the synthesized protein, as compared when there was no mutation? Specify type of mutation in relation to protein function. Is the base substitution a transition or transversion…
3. DNA polymerase made a mistake and added a C on the DNA template strand. In the space on the mRNA sequence below, write the added base. (Remember that the DNA template and mRNA are complementary. Mark the codons again and write the amino acid sequence beneath them. What do you observe? (5') CGUUACAAUGUAU CGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA 3' On this mRNA codon table, the first nucleotide in codon is to the left, the second is above, and third is to the right. 4. A mutation in the gene encoding the aminoacyl tRNA synthetase for valine (VAL) causes the tRNA binding site to have the wrong shape. In its new (mutant) shape, the enzyme can bind tRNAs for VAL and leucine (LEU). (not at the same time but enzymes work fast and there are lots of them) a. In cells with this mutant tRNA synthetase, will the protein product of translation match the original one you deduced in question 2? circle one: (YES / NO. ) b. If not, how does it differ? c. How many different version of the short…
1. Using this image of DNA & RNA explain the difference between DNA & RNA NH Thymine Cytosine Adenine Guanine Nucleobases of DNA Base pair Helix of sugar phosphates DNA Deoxyribonucleic acid read and then summarize in YOUR OWN WORDS Nucleobases RNA Ribonucleic Acid NH Uracil Cytosine Adenine Guanine Nucleobases of RNA
The diagram shows a short section of a single strand of DNA. A A ACC T Which strand of DNA will combine with this strand to form part of a double helix? doubxe C T T C L OB O C O D C A CT C T B AAG LL ရွေးချယ်မှုကို ဖယ်ရှားရန် G ၁ မှတ် G G A