Foundations in Microbiology
10th Edition
ISBN: 9781259705212
Author: Kathleen Park Talaro, Barry Chess Instructor
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 9.1, Problem 2ELO
2. Compare the basic nature of genetic material in eukaryotes, prokaryotes, and viruses.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
1. Explain what is the size of the Escherichia coli chromosome, how many proteins can it encode and what other genetic elements might be present in E. coli?
6. If 16% of the bases found in an organism's DNA are
made up of adenine, what percentage of cytosine will
be found in that DNA (assume the organism's DNA is
double stranded)?
2. Describe what is meant be the antiparallel arrangement of DNA.
Chapter 9 Solutions
Foundations in Microbiology
Ch. 9.1 - 1. Define heredity, genetics, genome, gene,...Ch. 9.1 - 2. Compare the basic nature of genetic material in...Ch. 9.1 - 3. Explain how DNA is organized and packaged.Ch. 9.1 - 4. Describe the chemical structure of DNA and Its...Ch. 9.1 - Prob. 5ELOCh. 9.1 - 6. Describe the process of DNA replication as it...Ch. 9.1 - 1. Compare the genetic material of eukaryotes,...Ch. 9.1 - 2. Characterize the organization of genetic...Ch. 9.1 - Prob. 3CYPCh. 9.1 - 4. What are the fundamental building blocks of DNA...
Ch. 9.1 - 5. Describe what is meant by the antiparallel...Ch. 9.1 - 6. Explain the synthesis of the leading and...Ch. 9.1 - 7. Name several characteristics of DNA structure...Ch. 9.2 - Prob. 7ELOCh. 9.2 - Prob. 8ELOCh. 9.2 - 9. Describe the different types of RNA and their...Ch. 9.2 - Prob. 10ELOCh. 9.2 - 11. Describe the genetic code, codons, and...Ch. 9.2 - 12. Recount the participants and steps in...Ch. 9.2 - Prob. 13ELOCh. 9.2 - 8. How is the language of a gene expressed?Ch. 9.2 - Prob. 9CYPCh. 9.2 - 10. Construct a table that compares the structure...Ch. 9.2 - Prob. 11CYPCh. 9.2 - Prob. 12CYPCh. 9.2 - Prob. 13CYPCh. 9.2 - Prob. 14CYPCh. 9.2 - 15. Briefly describe the events in translation.Ch. 9.2 - Prob. 16CYPCh. 9.2 - 17. Summarize how bacterial and eukaryotic cells...Ch. 9.2 - Prob. 18CYPCh. 9.3 - 14. Explain the functions of operons in bacterial...Ch. 9.3 - 15. Describe the main features of the lactose...Ch. 9.3 - 16. Describe the main features of repressible...Ch. 9.3 - 17. Summarize some aspects of genetic control by...Ch. 9.3 - 19. What is an operon? Describe the functions of...Ch. 9.3 - 20. Compare and contrast the lac operon and...Ch. 9.3 - Prob. 21CYPCh. 9.3 - 22. At which levels of DNA regulation do small...Ch. 9.4 - Prob. 18ELOCh. 9.4 - Summarize the causes and types of mutations and...Ch. 9.4 - Prob. 20ELOCh. 9.4 - Compare beneficial and detrimental effects of...Ch. 9.4 - Explain what is meant by the terms mutation and...Ch. 9.4 - Describe the primary causes, types, and outcomes...Ch. 9.4 - Explain the purposes behind replica plating and...Ch. 9.5 - Explain recombination in bacteria and what it...Ch. 9.5 - Describe the main features of conjugation and its...Ch. 9.5 - Prob. 24ELOCh. 9.5 - Identify the basic processes involved in...Ch. 9.5 - Discuss transposons and their importance to...Ch. 9.5 - Compare conjugation, transformation, and...Ch. 9.5 - Explain the differences between general and...Ch. 9.5 - By means of a flowchart, show the possible jumps...Ch. 9.6 - Explain the major elements of viral genetics.Ch. 9.6 - Compare aspects of the genetics of DNA and RNA...Ch. 9.6 - Explain why some viruses must enter the nucleus to...Ch. 9.6 - Explain the difference between positive-strand and...Ch. 9.6 - Outline the basic steps in the replication cycles...Ch. 9.L1 - What is the smallest unit of heredity (genotype)?...Ch. 9.L1 - Prob. 2MCQCh. 9.L1 - The nitrogen bases in DNA are bonded to the a....Ch. 9.L1 - DNA replication is considered semiconservative...Ch. 9.L1 - In DNA, adenine is the complementary base for...Ch. 9.L1 - The base pairs are held together primarily by a....Ch. 9.L1 - Why must the lagging strand of DNA be replicated...Ch. 9.L1 - Messenger RNA is formed by _______ of a gene on...Ch. 9.L1 - Prob. 9MCQCh. 9.L1 - Prob. 10MCQCh. 9.L1 - Prob. 11MCQCh. 9.L1 - Prob. 12MCQCh. 9.L1 - Prob. 13MCQCh. 9.L1 - Prob. 14MCQCh. 9.L1 - Which genetic material could be transmitted...Ch. 9.L1 - Prob. 16MCQCh. 9.L1 - Which of the following is present in prokaryotes...Ch. 9.L1 - Multiple Matching. Fill in the blanks with all the...Ch. 9.L1 - Prob. 1CSRCh. 9.L1 - Prob. 2CSRCh. 9.L1 - Explain how it would be possible for A. baumannii...Ch. 9.L1 - Prob. 1WCCh. 9.L1 - Prob. 2WCCh. 9.L1 - The following sequence represents triplets on DNA:...Ch. 9.L1 - Describe the actions οf all of the enzymes...Ch. 9.L1 - Prob. 5WCCh. 9.L1 - Examine the following series of words and identify...Ch. 9.L2 - Knowing that retroviruses operate on the principle...Ch. 9.L2 - Using the piece of DNA in writing-challenge...Ch. 9.L2 - Why will a mistake in the RNA code alone not...Ch. 9.L2 - The enzymes required to carry out transcription...Ch. 9.L2 - Prob. 5CTCh. 9.L2 - Activation, transcription, and translation of the...Ch. 9.L2 - Explain the mechanisms by which RNA can control...Ch. 9.L2 - Ex�Ιain how epigenetics is related to the...Ch. 9.L2 - Use the concepts of chapters, letters, a whole...Ch. 9.L2 - From figure 9.17, step 3. Label each part of the...Ch. 9.L2 - Examine figure 8.11, and explain which type of...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- 25. A bacteriophage virus infects a bacterial cell, causing the cell's own chromosomal DNA to become fragmented. One of the new bacteriophage viruses being assembled in the cell accidentally scoops up some of the bacterium's chromosomal DNA. This bacteriophage virus goes on to infect a new bacterium. When it does so, it inserts DNA from the previous cell into the new cell. That DNA becomes integrated into the new cell's genome. This gene transfer process between bacteria is referred to as: A: Transformation OB: Transduction O C: Transcription OD: Conjugationarrow_forward4. Explain the following relationship: DNA formats RNA, which makes proteins.arrow_forward2. what is A structure composed of DNA and associated proteins that in total contain the genome of an organism?arrow_forward
- 1. How many codons are there in the Original DNA sequence?arrow_forward1. Give at least two differences between prokaryotic and eukaryotic DNAsarrow_forward5. You imagine that not all life forms (including viruses and aliens) must have double stranded DNA molecule as their genetic material. Theoretically, a genome can be made of single stranded DNA, single stranded RNA, double stranded DNA, double stranded RNA and a double stranded hybrid of DNA/RNA. Which type of genomes do the following organisms have? a) Genome = 15% G, 0%T, 15%C, 35%U, 35%A b) Genome = 31%G, 19%T, 31%C, 0%U, 19%Aarrow_forward
- 21.An RNA or DNA molecule is a polymer made of subunits called 22.Which of the following is NOT needed for protein synthesis a, tRNA b, spindle fibers c, enzymes d, ribosomes 23. What does DNA do inside the cell? it destroys incorrect nucleotides in the nucleus it maintains the integrity of the nuclear membrane It prevents the excess buildup of nucleotide bases it directs the synthesis of proteins 24. What is a genome? Group of answer choices The complete collection of an organisms genetic information The combination of proteins and DNA found in the sex cells All the genes found in a population The number of chromosomes found in each cellarrow_forward2. List the DNA strand sequence complementary to the template strand. CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCCC . . .arrow_forward5. If 16% of the bases found in an organism's DNA are made up of adenine, what percentage of thymine will be found in that DNA (assume the organism's DNA is double stranded)?arrow_forward
- 7. Strand A represents one side of a DNA molecule, while Strand B represents a growing RNA molecule. Where would this interaction be expected to take place? * STRAND A STRAND B KEY ADENINE THYMINE GUANINE CYTOSINE URACIL cell membrane O ribosome nucleus vacuolearrow_forward10.In the diagram below, Transcribe the two new complementary strands of DNA. ATTGCCA AGT ATTGCCAAGT TAACGGTTCA TAACGG TT C Aarrow_forward4. It is known that RNA is a nucleic acid responsible for the synthesis of proteins. However, there is another nucleic acid alongside RNA: DNA. What role does the latter play in relation to RNA? a) RNA is synthesized in the cell in case too large a mutation damages the DNA. b) DNA has the reproductive genetic code of all cells and passes it on to RNA. c) DNA directs the synthesis of enzymes, while RNA synthesizes proteins. d) DNA synthesizes RNA according to a blueprint that includes the guidelines necessary for the structure of proteins.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
An Introduction to the Human Genome | HMX Genetics; Author: Harvard University;https://www.youtube.com/watch?v=jEJp7B6u_dY;License: Standard Youtube License