Biology
5th Edition
ISBN: 9781260487947
Author: BROOKER
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 21.1, Problem 3CC
Summary Introduction
To explain: The reason that primers used in PCR bind specifically to the primer-annealing sites.
Introduction: PCR stands for “Polymerase Chain Reaction”. It is a widely used technique in the field of molecular biology. It is used to make a number of exact copies of a single DNA. PCR was developed by a scientist named Kary Mullis. The basic requirements of a PCR technique are primers (forward and reverse), deoxynucleoside triphosphates and Taq polymerase.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Expand PCR? Describe the different Steps involved in this technique?
Primer designing: A single-stranded DNA sequence (963 nucleotides) that codes for a hypothetical protein are
shown below (lower case shaded blue).
1. Design a pair of forward and reverse primers (~18 nucleotides long each) with EcoRI and
BamHI added at 5' and 3' ends, respectively, for the amplification and cloning of this
a plasmid with the same restriction sites.
gene
into
GTATCGATAAGCTTGATATCGAATTCatggctaaaggcggagct cccgggttca aagtcgcaat acttggcgct
gccggtggcattggccagccccttgcgatgttgatgaagatgaatcctctggtttctgttctacatctatatgatgtagtcaatgcccctggtgtcaccgctgatatta
gccacatggacacgggtgctgtggtgcgtggattcttggggcagcagcagctggaggctgcgcttactggcatggatcttattatagtccctgcaggtgttcctcg
aaaaccaggaatgacgagggatgatctgttcaaaataaacgcaggaattgtcaagactctgtgtgaagggattgcaaagtgttgtccaagagccattgtcaacctg
atcagtaatcctgtgaactccaccgtgcccatcgcagctgaagttttcaagaaggctggaacttatgatccaaagcgacttctgggagttacaatgctcgacgtagt
cagagccaatacctttgtggcagaagtattgggtcttgatcctcgggatgttgatgttccagttgttggcggtcatgetggtgtaaccatttgccccttctatctcagg…
What is the meaning of proofreading activity ?
O A. The polymerase checks for the correct incorporation of nucleotides at the 5'end of the chain
B. The polymerase checks for the correct incorporation of nucleotides at the 3'end of the growing chain
O C. The polymerase does not attach to an unspecific primer binding to the template
O D. The polymerase is highly resistant to high temperatures, showing a prolonged half life
O E. The Taq polymerase does not binds to the primer dimers
Chapter 21 Solutions
Biology
Ch. 21.1 - Prob. 1CSCh. 21.1 - Prob. 1CCCh. 21.1 - Prob. 2CCCh. 21.1 - Prob. 3CCCh. 21.2 - Prob. 1CCCh. 21.2 - Prob. 2CCCh. 21.2 - Prob. 3CCCh. 21.3 - Prob. 1EQCh. 21.3 - Prob. 2EQCh. 21.3 - Prob. 3EQ
Ch. 21.4 - Prob. 1CCCh. 21.4 - Prob. 1CSCh. 21.5 - Prob. 1CSCh. 21.5 - Repetitive Sequences and Transposable Elements...Ch. 21 - Prob. 1TYCh. 21 - DNA ligase is needed in a cloning experiment a. to...Ch. 21 - Prob. 3TYCh. 21 - Why is Taq polymerase used in PCR rather than...Ch. 21 - Lets suppose you want to clone a gene that has...Ch. 21 - In the CRISPR-Cas technology for editing genes,...Ch. 21 - Prob. 7TYCh. 21 - The enzyme that helps short segments of DNA move...Ch. 21 - Prob. 9TYCh. 21 - Which of the following was not a goal of the Human...Ch. 21 - Prob. 1CQCh. 21 - Briefly describe whether or not each of the...Ch. 21 - Prob. 3CQCh. 21 - Identify and discuss three important advances that...Ch. 21 - Prob. 2COQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- TOPIC: PCR and Gene Cloning Basics Question: What are 2 possible roles of CaCl2 in the transformation process?arrow_forwardPrimer Development Pick your favorite gene and develop primers for a target within the gene. Provide the following information: Gene name: Species: Accession number: Primer target: Primer Output: Explain why you selected this primer set.arrow_forward. You need to amplify a gene from a source DNA for cloning in any cloning vector, which enzymes will be used to accomplish the task? Discuss role of each enzyme used for cloning a gene in step wise order.arrow_forward
- . Propose a mechanism by which a type II topoisomerase could use the energy of ATP hydrolysis to scan a large DNA molecule and, thereby, to direct that the enzyme will catalyze largely “disentan- gling" reactions (decatenation and unknotting).arrow_forwardRecall that constructs used for floxing a gene contain,within one of the gene’s introns, two loxP sites flanking a gene for neomycin resistance (Fig. 18.11a). AloxP site is only 34 base pairs long, as shown in thefollowing figure.ATAACTTCGTATA ATGTATGC TATACGAAGTTATInverted repeat Spacer Inverted repeatExplain how you could use PCR to generate a neomycin resistance gene flanked by loxP sites, starting witha plasmid containing a neorgene. If you had the intronof the target gene cloned in a plasmid vector, howcould you insert your PCR product into the intron?arrow_forwardDescribe your amplicon based on molecular size. Comparing the size of the genomic DNA Describe your amplicon based on molecular size. Comparing the size of the genomic DNA (as seen in Fig. 8.1) and the PCR products based on band position in the gel (as seen in Fig. 8.2).arrow_forward
- Can you help with 1a please HELPFUL INFORMATION: When performing classical Sanger or "dideoxy" sequencing, you set up 4 parallel reactions per template to be sequenced from a specific primer, with each of the four reactions containing a different dideoxynucleotide, and then the four reactions were run in a separate, adjacent lanes on a gel. 1a. Why couldn't you combine all 4 dideoxynucleotides with the primer and the template and do the whole reaction in one tube, and then run the set of fragments produced by the reaction mixture on a single lane in an acrylamide gel?arrow_forwardshow your rationale How many RT-PCR products generated from 13 copies of mRNA (= cDNA) from 33 PCR amplification cycles? What was the original starting number of mRNA molecules if after 36 PCR cycles, the reaction had generated 996,432,412,672 copies?arrow_forwardPCR-amplify the Tat coding region from the isolated DNA. Clone the PCR product into a pcDNA3.1 mammalian expression vector. Grow E. coli for the production of purified plasmid DNA stocks for later use. 1.What is the minimum biosafety level recommended by the BMBL for this experiment? 2. do this experiment involve a recombinant DNA?arrow_forward
- Clone number in this case is number 196 as shown in the images. What is the exact length of the segment of human DNA that has been inserted into the plasmid? *report the entire length of the insert, not just the sequences matching the ends and labels of wells isn't needed for answer*arrow_forwardPrimers designing for epitope tagging: Design forward and reverse primers to amplify the following gene with 6×HIS-tag on the N-terminus of the protein. To be cleaved and inserted into the plasmid, add restriction sites for EcoRI and HindIII at 5' and 3'. ATGCTCTCCGCCCTCGCCCGGCCTGTCAGCGCTGCTCTCCGCCGCAGCTTCAGCACCTCAGCC CAGAACAATGCTAAAGTAGCTGTGCTAGGGGCCTCTGGAGGCATCGGGCAGCCACTTTCAC TTCTCCTGAAGAACAGCCCCTTGGTGAGCCGCCTGACCCTCTATGATATCGCGCACACACCC GGAGTGGCCGCAGATCTGAGCCACATCGAGACCAAAGCCGCTGTGAAAGGCTACCTCGGAC CTGAACAGCTGCCTGACTGCCTGAAAGGTTGTGATGTGTAAarrow_forwardPreparing plasmid DNA (double stranded, circular) for Sanger sequencing involves annealing a complementary, single-stranded oligonucleotide DNA primer to one strand of the plasmid template. This is routinely accomplished by heating the plasmid DNA and primer to 90°C and then slowly bringing the temperature down to 25°C. Why does this protocol work? What enzyme is used and what other components are required in the sequencing reaction? How does the Sanger method determine the sequence?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License