Recall that constructs used for floxing a gene contain,within one of the gene’s introns, two loxP sites flanking a gene for neomycin resistance (Fig. 18.11a). AloxP site is only 34 base pairs long, as shown in thefollowing figure.ATAACTTCGTATA ATGTATGC TATACGAAGTTATInverted repeat Spacer Inverted repeatExplain how you could use PCR to generate a neomycin resistance gene flanked by loxP sites, starting witha plasmid containing a neorgene. If you had the intronof the target gene cloned in a plasmid vector, howcould you insert your PCR product into the intron?

Recall that constructs used for floxing a gene contain,within one of the gene’s introns, two loxP sites flanking a gene for neomycin resistance (Fig. 18.11a). AloxP site is only 34 base pairs long, as shown in thefollowing figure.ATAACTTCGTATA ATGTATGC TATACGAAGTTATInverted repeat Spacer Inverted repeatExplain how you could use PCR to generate a neomycin resistance gene flanked by loxP sites, starting witha plasmid containing a neorgene. If you had the intronof the target gene cloned in a plasmid vector, howcould you insert your PCR product into the intron?

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter13: An Introduction To Genetic Technology

Section: Chapter Questions

Problem 16QP: Cloned Libraries You are running a PCR to generate copies of a fragment of the cystic fibrosis (CF)...

See similar textbooks

Similar questions

E. coli K12 genomic DNA (expected PCR product was 3075bp). For expression the gene was cloned into the expression plasmid pET28a (Novagen), where expression is under control of the inducible T7 promoter.Give information about the enzyme being purified, its expression in E. coli and the property being used for its purification. please provide the references for the answer.
2) explain why it is far less important for Primase to have proofreading activity than it is for DNA polymerase. 60-word limit
Recall what you know about the rules of gel electrophoresis and the migration of DNA on an electrophoresis gel. The PV92 PCR products could be 941bp or 641bp long. We are calling the longer allele that has the Alu insert the "+" allele and the shorter allele that doesn't have the insert the "-" allele. Which fragment will run faster on the electrophoresis gel, the 941bp or the 641bp allele? 941 641
Clone number in this case is number 196 as shown in the images. What is the exact length of the segment of human DNA that has been inserted into the plasmid? *report the entire length of the insert, not just the sequences matching the ends and labels of wells isn't needed for answer*
You are interested in synthesizing a variant of Synechocystis sp. pcc 7803 ferredoxin having mutation (E) at its 38th residue. The gene is encoded in a pET21b vector (5.3 kbp). Estimate the amount of time needed to run a PCR for the site-directed mutagenesis for25 vs 30 cycles.
Primer designing: A single-stranded DNA sequence (963 nucleotides) that codes for a hypothetical protein are shown below (lower case shaded blue). 1. Design a pair of forward and reverse primers (~18 nucleotides long each) with EcoRI and BamHI added at 5' and 3' ends, respectively, for the amplification and cloning of this a plasmid with the same restriction sites. gene into GTATCGATAAGCTTGATATCGAATTCatggctaaaggcggagct cccgggttca aagtcgcaat acttggcgct gccggtggcattggccagccccttgcgatgttgatgaagatgaatcctctggtttctgttctacatctatatgatgtagtcaatgcccctggtgtcaccgctgatatta gccacatggacacgggtgctgtggtgcgtggattcttggggcagcagcagctggaggctgcgcttactggcatggatcttattatagtccctgcaggtgttcctcg aaaaccaggaatgacgagggatgatctgttcaaaataaacgcaggaattgtcaagactctgtgtgaagggattgcaaagtgttgtccaagagccattgtcaacctg atcagtaatcctgtgaactccaccgtgcccatcgcagctgaagttttcaagaaggctggaacttatgatccaaagcgacttctgggagttacaatgctcgacgtagt cagagccaatacctttgtggcagaagtattgggtcttgatcctcgggatgttgatgttccagttgttggcggtcatgetggtgtaaccatttgccccttctatctcagg…
STEP BY STEP Exaplanation would be appreciated so I can understand for upcomming exam. In humans, the COL1A1 locus codes for a collagen protein found in bone. A recessive COLA1 allele believed to reduce bone density and increase risk of fractures differs from the wild type allele by the presence a GT in the first intron of the gene. This mutation can be easily screened by PCR, using COL1A1-specific primers followed restriction enzyme digest of the product with MscI. The normal allele is denoted as G and the recessive allele as T. A recent study of 894 women found that 570 were GG, 291 were GT and 33 were TT. (Assume for this exercise that these values reflect both male and female values for the sampled population. What are the frequencies of each allele? What are the frequencies of each genotype? c. Is this locus in Hardy-Weinberg equilibrium? Use the table below to evaluate the significance of any deviation from H-W expectations.
Clone number in this case is number 196 which is shown in the images. State whether a BamHI site has been re-created at the forward- and the reverse-end junctions of the human DNA with the plasmid vector band sizes are shown in one of the images. (0.5, 1, 2, 3, 4, 5, 6, 8, 10kb)
Primers designing for epitope tagging: Design forward and reverse primers to amplify the following gene with 6×HIS-tag on the N-terminus of the protein. To be cleaved and inserted into the plasmid, add restriction sites for EcoRI and HindIII at 5' and 3'. ATGCTCTCCGCCCTCGCCCGGCCTGTCAGCGCTGCTCTCCGCCGCAGCTTCAGCACCTCAGCC CAGAACAATGCTAAAGTAGCTGTGCTAGGGGCCTCTGGAGGCATCGGGCAGCCACTTTCAC TTCTCCTGAAGAACAGCCCCTTGGTGAGCCGCCTGACCCTCTATGATATCGCGCACACACCC GGAGTGGCCGCAGATCTGAGCCACATCGAGACCAAAGCCGCTGTGAAAGGCTACCTCGGAC CTGAACAGCTGCCTGACTGCCTGAAAGGTTGTGATGTGTAA
Knowing that you are using HindIII and EcoRI to cut your plasmids, and that those two enzymes cut within the MCS, use the map of pUC19 provided below to compute: What will be the sizes of the 2 restriction fragments if NO insert is present in pUC19? What will be the sizes of the 2 restriction fragments if the approximately 317 bp RT-PCR product (insert from WT satC dimer) was ligated successfully into the SmaI site? What will be the sizes of the 2 restriction fragments if TWO approximately 317 bp RT-PCR products (2 ligated inserts from WT satC dimer) were ligated into the SmaI site?
1)explain why it is far less important for RNA Polymerase to have proofreading activity than it is for DNA polymerase.60-word limit
Can you help with 1a please HELPFUL INFORMATION: When performing classical Sanger or "dideoxy" sequencing, you set up 4 parallel reactions per template to be sequenced from a specific primer, with each of the four reactions containing a different dideoxynucleotide, and then the four reactions were run in a separate, adjacent lanes on a gel. 1a. Why couldn't you combine all 4 dideoxynucleotides with the primer and the template and do the whole reaction in one tube, and then run the set of fragments produced by the reaction mixture on a single lane in an acrylamide gel?