Genetics: Analysis and Principles
6th Edition
ISBN: 9781259616020
Author: Robert J. Brooker Professor Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 19, Problem 7CONQ
Summary Introduction
To review:
The kind of mutations that are present in DNA (deoxyribonucleic acid) sequences when comparing the given sequence
A.
B.
C.
D.
Introduction:
Point mutations are a common type of mutation in which a lone
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
The template strand of a segment of double-helical DNA contains the sequence –
5’-CTT-AAC-ACC-CCT-GAC-TTC-GCG-CCG-CAT-3’
a. What is the base sequence of the complementary strand of DNA? Indicate the 5’ and the 3’ ends.
b. What is the base sequence of the mRNA that can be transcribed from this template DNA strand? Indicate the 5’ and the 3’ ends.
c. What amino acid sequence can be coded by the mRNA in (b) starting from the 5’ end (or the N terminal amino acid)?
-Write down the complementary DNA sequence.
TACCTAGCG CACATGTAGGTGGGCAAAGTT
-Write down the complementary mRNA sequence for each of the following DNA sequence.
A: TACCTAGCGCACATGTAGGTGGGCAAAGTT
B:
TAC ATG GTT ACA GTC TAT TAG ATG CTA TTT ACT TAG
-If the first G changes to A what kind of mutation will happen? Show the change in amino acid sequence.
This is base substitutions involve the replacement of one nucleotide with another. And it changes one amino acid coding, producing a missense mutation
TAC CTA GCA CAC ATGTAGGTGGGCAAAGTT
TAC CTA ACACACATGTAGGTGGGCAAAGTT
This is part of the Escherichia coli DNA sequence that contains an inverted repeat.
(Note: top strand is the coding strand).
5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3'
3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5'
Draw the structure of hairpin loop that will be formed during the end of transcription.
Chapter 19 Solutions
Genetics: Analysis and Principles
Ch. 19.1 - 1. A mutation changes a codon that specifies...Ch. 19.1 - A down promoter mutation causes the promoter of a...Ch. 19.1 - 3. A mutation in one gene that reverses the...Ch. 19.1 - Which of the following is an example of a somatic...Ch. 19.2 - Prob. 1COMQCh. 19.3 - Which of the following is not an example of a...Ch. 19.3 - A point mutation could be caused by a....Ch. 19.3 - One way that TNRE may occur involves the formation...Ch. 19.4 - Nitrous acid replaces amino groups with keto...Ch. 19.4 - Prob. 2COMQ
Ch. 19.4 - Prob. 3COMQCh. 19.5 - The function of photolyase is to repair a....Ch. 19.5 - Which of the following DNA repair systems may...Ch. 19.5 - 3. In nucleotide excision repair in E. coli, the...Ch. 19.5 - Prob. 4COMQCh. 19.5 - An advantage of translesion-replicating...Ch. 19 - Is each of the following mutations a transition,...Ch. 19 - Prob. 2CONQCh. 19 - What does a suppressor mutation suppress? What is...Ch. 19 - Prob. 4CONQCh. 19 - X-rays strike a chromosome in a living cell and...Ch. 19 - Prob. 6CONQCh. 19 - Prob. 7CONQCh. 19 - 8. A point mutation occurs in the middle of the...Ch. 19 - Prob. 9CONQCh. 19 - Prob. 10CONQCh. 19 - 11. Is a random mutation more likely to be...Ch. 19 - 12. Which of the following mutations could be...Ch. 19 - Prob. 13CONQCh. 19 - Discuss the consequences of a germ-line versus a...Ch. 19 - Prob. 15CONQCh. 19 - Explain how a mutagen can interfere with DNA...Ch. 19 - What type of mutation (transition, transversion,...Ch. 19 - Explain what happens to the sequence of DNA during...Ch. 19 - Distinguish between spontaneous and induced...Ch. 19 - Prob. 20CONQCh. 19 - Prob. 21CONQCh. 19 - Prob. 22CONQCh. 19 - Trinucleotide repeat expansions (TNREs) are...Ch. 19 - 24. With regard to TNRE, what is meant by the term...Ch. 19 - 25. What is the difference between the mutation...Ch. 19 - Achondroplasia is a rare form of dwarfism. It is...Ch. 19 - Prob. 27CONQCh. 19 - In the treatment of cancer, the basis for many...Ch. 19 - Prob. 29CONQCh. 19 - 30. Which of the following examples is likely to...Ch. 19 - Prob. 31CONQCh. 19 - Prob. 32CONQCh. 19 - Prob. 33CONQCh. 19 - With regard to the repair of double-strand breaks,...Ch. 19 - Prob. 35CONQCh. 19 - Prob. 36CONQCh. 19 - 37. Three common ways to repair changes in DNA...Ch. 19 - Prob. 38CONQCh. 19 - Prob. 39CONQCh. 19 - Explain how the technique of replica plating...Ch. 19 - 2. Outline how you would use the technique of...Ch. 19 - 3. From an experimental point of view, is it...Ch. 19 - Prob. 4EQCh. 19 - Prob. 5EQCh. 19 - 6. Richard Boyce and Paul Howard-Flanders...Ch. 19 - In E. coli, a variety of mutator strains have been...Ch. 19 - 2. Discuss the times in a person’s life when it is...Ch. 19 - A large amount of research is aimed at studying...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top strand is the coding strand). 5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3' 3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5' (i) Draw the structure of hairpin loop that will be formed during the end of transcription. (ii) Describe the function of the hairpin loop during transcription.arrow_forwardBelow is the DNA sequence of a patient with overlapping genes (a single mRNA has multiple initiation points for translation) for two different proteins (DADαs and AMA): 5’- GTCCCAACCATGCCCACCGATCTTCCGCCTGCTTCTGAAGATGCGGGCCCAGGGAAATCTCTAACG-3’ 1. Indicate the DNA sequence coding for RNA. 2. Indicate the amino acid sequence of each of them.arrow_forwardThe sequence of the coding strand of a bacterial gene is given below. The positions of the first nine bases are numbered for your convenience. A missense mutation was introduced at position seven where the C was changed to a T resulting a mutant gene. 123456789 5'- ATGGCCCGACCGCAACTTTTCCGAGCTCTGGTGTCTGCGCAGTGACC-3 a. Write the template DNA (complementary strand) sequence for the wild type gene above b. Write the DNA sequence of the mutant gene (Both DNA strands) c. Write the sequence of mRNA produced from the mutant gene d. Write the sequence of the mutant protein using the codon usage table provided in the end of this document.arrow_forward
- Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’1. If the above DNA strand is the coding (sense) strand and the DNA molecule is transcribed, what is the correct nucleotide sequence and direction of the RNA formed after transcription?arrow_forwardConsider the following portion of mRNA produced by the normal order of DNA nucleotides: 5’ – CUU AAA CCA GUU – 3’ a. What is the template DNA sequence that was used to synthesize this portion of mRNA? b. What is the amino acid order produced from this mRNA? c. Write the amino acid sequence if a mutation changes CUU to CAU. Is this likely to affect protein function?arrow_forwardThe sequence below is of the DNA duplex for a gene in which transcription begins with the nucleotide highlighted by the arrow. If the upper strand shown is the template strand, write the sequence you expect for the mRNA transcribed from this gene. Please write 5' to 3'. 5'-[x]-3' 5'-TACGTGACGGTAATACTAGC-3' 3'-ATGCACTGCCATTATGATCG-5'arrow_forward
- Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences: 5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’ 1. If the above DNA strand is the coding (sense) strand and the DNA molecule is transcribed, what is the correct nucleotide sequence and direction of the RNA formed after transcription? 2. If the RNA synthesized above (item #1) is a functional mRNA and all the nucleotides belong to an exon, a. how many codons are present in this mRNA? b. how many codons actually code for proteins in this mRNA? c. what stop codon is present in this mRNA?arrow_forwardgive the amino acids specified by the following bacterial mRNA sequences. a. 5′ –AUGUUUAAAUUUAAAUUUUGA–3′ b. 5′ –AGGGAAAUCAGAUGUAUAUAUAUAUAUGA–3′ c. 5′ –UUUGGAUUGAGUGAAACGAUGGAUGAAAG AUUUCUCGCUUGA–3′ d. 5′ –GUACUAAGGAGGUUGUAUGGGUUAGGGG ACAUCAUUUUGA–3′arrow_forwardThe following triplets constitute anticodons found on a series of tRNAs. Name the amino acid carried by each of these tRNAs. a. 5′ –UUU–3′ b. 5′ –GAC–3′ c. 5′ –UUG–3′ d. 5′ –CAG–3′arrow_forward
- Given the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs ( what letter changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein. Wild Type DNA Sequence: 3' - AGGCTCGCCTGT - 5' Mutated DNA Sequence: 3' - AGTCTCGCCTGT - 5'arrow_forwardHelp me pleasearrow_forwarda. If a single transition occurs in a codon that specifies Phe, what amino acids can be specified by the mutated sequence? b. If a single transversion occurs in a codon that specifies Phe, what amino acids can be specified by the mutated sequence? c. If a single transition occurs in a codon that specifies Leu, what amino acids can be specified by the mutated sequence? d. If a single transversion occurs in a codon that specifies Leu, what amino acids can be specified by the mutated sequence?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Mitochondrial mutations; Author: Useful Genetics;https://www.youtube.com/watch?v=GvgXe-3RJeU;License: CC-BY