Consider the following portion of mRNA produced by the normal order of DNA nucleotides: 5’ – CUU AAA CCA GUU – 3’ a. What is the template DNA sequence that was used to synthesize this portion of mRNA? b. What is the amino acid order produced from this mRNA? c. Write the amino acid sequence if a mutation changes CUU to CAU. Is this likely to affect protein function?

Q: Derive the amino acid sequence that is coded for by each of the following mRNA sequence.  5' CAA…

A: Amino acid are molecules which are combine to form a protein molecules.Amino acid are synthesized by…

Q: Here is a eukaryotic gene. The numbers given are base pairs of exon and intron. How long in bases…

A: In eukaryotic organisms, the gene contains introns as well as exons.  Eukaryotic genomes are much…

Q: A). What is the amino acid sequence of the polypeptide produced from a eukaryotic gene that has the…

A: Transcription  The process on making mRNA from DNA which further get translated into polypeptide…

Q: The hypothetical mRNA sequence below contains the coding region for a short peptide. What…

A: Mutation generally occurs when the base pair of the DNA gets altered by Mutagens or other chemicals…

Q: The coding strand has the following sequence. Please answer the questions below with regard to this…

A: The coding strands run in 3' to 5' direction and has codons it is transcribed as it is in the mRNA…

Q: You may wish to consult the genetic code above to answer the following question. A mutation has…

A: Missense mutation is the mutation in which single amino acid change occurs. The other amino acid in…

Q: Which of the following is the MRNA coding for the peptide trp-met-gly- ser-his? A.…

A: The genetic codes are the sequence of nucleotide that governs the formation of proteins.

Q: Shown below is the sequence of the 5' end of a hypothetical mRNA. Where does translation of this…

A: Translation occurs when the mRNA gets attached to the ribosome and subunits and the initiation…

Q: The following represent deoxyribonucleotide sequences in the template strand of DNA: Sequence 1:…

A: BASIC INFORMATION TRANSCRIPTION  It is responsible for the formation of hnRNA which has the codes…

Q: Draw a typical eukaryotic gene and the pre-mRNA and mRNA derived from it. Assume that the gene…

A: Introduction A genome is consists of transcriptionally active genes. These genes form mRNA as they…

Q: Shown below is an R loop prepared for electron microscopy by annealing a purified eukaryotic…

A: An R-loop refers to a structure formed by a DNA (deoxyribonucleic acid) and an RNA molecule. As a…

Q: Shown below is an R loop prepared for electron microscopy by annealing a purified eukaryotic…

A: An exon is any part of a gene that will encode a part of the final mature RNA produced by that gene…

Q: The length of a particular gene in human DNA, measured from the start site for transcription to the…

A: Transcription is a process of formation of transcript or RNA from DNA by the process of…

Q: Which of the following best describes the initiation of translation? A. The mRNA binds the large…

A:

Q: Which of the following describes the most likely effect that a single base substitution in the…

A: Point mutation It is a type of genetic mutation in which a single nucleotide base gets altered,…

Q: You have an mRNA transcript that is 201 nucleotides long, including the Start and Stop codons.  How…

A: In most living organisms, DNA is the genetic material. DNA contains all the genetic instructions…

Q: Which two sequences shown in the diagram are NOT directly transcribed from the template strand of…

A: ANSWER - in this figure the following sequences are not directly transcribed from the template…

Q: Which of the following mutations is most likely to cause a single amino acid difference during the…

A: The translation is the process of translating the sequence of a messenger RNA (mRNA) molecule to a…

Q: The base sequence of the gene coding for a short polypeptide is 5’CTACGCTAGGCGATTGATCATC’3. a) What…

A: According to the central dogma, the information flows From DNA to proteins. DNA is transcribes into…

Q: Consider the following gene with their respective introns and exons   5’ –…

A: Since you have asked multiple questions, we will solve the first three question for you. If you want…

Q: Draw a typical eukaryotic gene and the pre-mRNA and mRNA derived from it. Assume that the gene…

A: The typical eukaryotic gene consists of an exon, intron, promoter sequence, a terminator sequence,…

Q: If a mutation were found where additional five G/C (top/bottom) base pairs were inserted immediately…

A: The mutation is a sudden and heritable change in the sequence of an organism's genome that gives…

Q: Human wildtype and mutant alleles are identical in sequence except for a single base-pair…

A: A mutation is any change in the DNA sequence of a cell. It may alter one or a few base pairs or…

Q: A. If a nascent mRNA is composed of 540 nucleotide bases and its introns (2/3 of the total number of…

A: .If m-RNA is composed of 540 nucleotides and 2/3 introns are removed during RNA splicing then we…

Q: Transcribe the DNA strand given above to write the sequence of the mRNA strand in the 5’ to 3’…

A: According to Bartleby guidelines, we are required to attempt first three sub-parts in case of…

Q: Consider the following mRNA base sequence 5' CUU CAG 3 a What dipeptide is coded for this mRNA?…

A: Genetic codes are unambiguous that means one codon will code for only one amino acid. Codons are…

Q: Consider the following sequence of DNA: 3' - TACATGIIGTAG-5' a) Create a nonsense mutation with the…

A: DNA contains the genetic information for the physical characteristics of the human body. The DNA…

Q: Shown below is a double-stranded bacterial (E. coli) DNA sequence coding for a hypothetical protein.…

A: as per the question, the nucleotide sequencing is given of the E- Coli.  and the respective answer…

Q: Define the following terms as they apply to the genetic code: a. Reading frame b. Overlapping code…

A: Note - We answer one question at a time. The set of rules through which information in the DNA or…

Q: If the mRNA produced had the sequence ACGCGU, What would be the tRNA anticodon sequence?

A: mRNA is a messenger RNA that is synthesized from the DNA by the process called transcription. The…

Q: Which of the following is the definition of a gene?   A. RNA that delivers amino acids to a ribosome…

A: Genetics is a science of the study of genes. It involves the identification of specific genes for…

Q: ook at the following sequence, " THE FAT CAT ATE THE CAT" Remove the first "H" and regroup the…

A: Note- According to the guidelines, only the first three questions can be answered out of MCQs.…

Q: A partial DNA sequence, a partial MRNA transcript, and part of the CFTR polypeptide in a cystic…

A: Cystic fibrosis is a disesase that damage the cell producing mucus, sweat and other juices.  in…

Q: A. What amino acid sequence is encoded by the codon sequence AUAAUGGUAACGGUU? B. Suppose the codon…

A: DNA is the carrier of genetic information in almost all organisms except certain RNA viruses such as…

Q: Below is a graphical representation of eukaryotic precursor mRNA.…

A: Introduction The mRNA which is produced during transcription process is not active form. To make the…

Q: - Shown below is an R loop prepared for electron microscopy by annealing a purified eukaryotic…

A: mRNA contains coding regions (exons) and non-coding regions (introns). The introns are removed by…

Q: The following is as segment of mRNA: 5'-UCGGAAUGUGGUGGCAUACAGGCUUACAGAACUAAGUCUGAGAAU-3'

A: 5'-UCGGAAUGUGGUGGCAUACAGGCUUACAGAACUAAGUCUGAGAAU-3'   As following the rules in Genetic code the…

Q: If mature eukaryotic MRNA is hybridized with its corresponding genomic DNA template strand and…

A: DNA is the genetic material and is present in the nucleus of the eukaryotic cells.

Q: Geneticists have found that when they cut out a eukaryotic gene from genomic DNA that they can…

A: DNA is double-stranded, but only one strand serves as a template for transcription at any given…

Q: Which of the following anticodons of a tRNA molecule can base pair with three different codons on an…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: Consider the mRNA base sequence 5' ACC CAC 3'. what dipeptide is coded for by this mRNA? *   A.…

A: The RNA molecule is made up of four nucleotide bases: adenine (A), cytosine (C), guanine (G), and…

Q: a) Examine the nudeotide sequence below, and determine the amino acid sequence encoded by this mRNA.…

A: a) The nucleotide and translated mRNA and amino acid sequences are given below: GGA GGC CTG GCC TAC…

Q: What happens when one base pair of DNA is lost from the coding region of a gene because of mutation?…

A: This type of mutation is known as Deletion mutation in which a single or entire sequence of…

Q: In a study of  several families for differences in the sequence of a particular gene suspected to…

A: The mutation is the change in the nucleic acid sequence that alters the way the particular gene gets…

Q: How might a single base substitution in the sequence of a gene affect the amino acid sequence of a…

A:

Q: Which of the following would probably cause the most severe damage to a gene's expression and…

A: A phenotype is expressed by a gene by the process of transcription of the gene from DNA to make an…

Q: Consider the following mRNA base sequence 5' CUG-CAC 3' (a) What dipeptide is coded for by this…

A: Messenger (mRNA) ribonucleic acid helps in the formation of protein as it contains the long base…

Q: . Consider the genetic code for the amino acid phenylalanine (abbreviations: Phe, F) and single base…

A: A codon is the triplet sequence of DNA or RNA nucleotides which corresponds either to specific amino…

Q: a) What is a mutation in molecular terms?      b) a mutation deletes a base in the genomic DNA…

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: Which of the following mutations in the protein-coding region of a gene is more likely to lead to…

A: A frameshift mutation is a type of gene mutation in which the insertion or deletion of one or more…