Genetics: Analysis and Principles
6th Edition
ISBN: 9781259616020
Author: Robert J. Brooker Professor Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 19, Problem 27CONQ
Summary Introduction
To review:
The effects on replication of the given DNA (deoxyribonucleic acid) sequence after the following treatments:
Treatment with nitrous acid.
Treatment with nitrous acid, followed by its removal, and then continued replication of DNA.
Introduction:
Nitrous acid is a common chemical agent that can act as a mutagen and causes deamination of bases. This can lead to a cytosine (C) getting converted into uracil (U), or adenine (A) getting converted into hypoxanthine (H), which can cause mutations in the DNA sequence.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
If we are given this segment of DNA:
TTGGHTGUTGG
HHUUTHUGHUU
Let’s suppose this DNA was treated with nitrous acid. The nitrous acid was then removed, and the DNA replicated for two generations. What would be the sequences of the DNA products after the DNA had replicated two times? (note Hypoxanthine pairs with cytosine) and so there would be four sets?
A DNA strand was sequenced using the Sanger method
(https://www.youtube.com/watch?v=KTstRrDTmWI). The reaction
tube contained the DNA strand, fluorescently labelled
dideoxynucleotide triphosphates (ddATP – yellow, ddGTP – green,
ddCTP – blue, ddTTP - red), deoxynucleotide triphosphates, DNA
polymerase, or its Klenow fragment. Synthesis of DNA is allowed to
proceed, and the results are shown on the right:
15
14
13
12
11
10
(a) What is the sequence of the copy and the template strands?
(b) If the template strand were in the 5'-3' direction, what will be
the sequence of the DNA copy?
Nucleotide Length
The chromatogram shows fluorescent peak data from a dye-terminating nucleotide-sequencing reaction. The peaks are shown
with shortest fragment on the left to longer fragments on the right.
T
•C
A
Select the DNA sequence that matches the data.
5-ТАТAСТТАСGAAGT-3'
5'-GTCCTACGGACGCG–3'
5'-ATATGAATGCTTCA–3'
5'-TGAAGCATTCATAT–3'
5-АСТТCGTAAGTATA-3'
Chapter 19 Solutions
Genetics: Analysis and Principles
Ch. 19.1 - 1. A mutation changes a codon that specifies...Ch. 19.1 - A down promoter mutation causes the promoter of a...Ch. 19.1 - 3. A mutation in one gene that reverses the...Ch. 19.1 - Which of the following is an example of a somatic...Ch. 19.2 - Prob. 1COMQCh. 19.3 - Which of the following is not an example of a...Ch. 19.3 - A point mutation could be caused by a....Ch. 19.3 - One way that TNRE may occur involves the formation...Ch. 19.4 - Nitrous acid replaces amino groups with keto...Ch. 19.4 - Prob. 2COMQ
Ch. 19.4 - Prob. 3COMQCh. 19.5 - The function of photolyase is to repair a....Ch. 19.5 - Which of the following DNA repair systems may...Ch. 19.5 - 3. In nucleotide excision repair in E. coli, the...Ch. 19.5 - Prob. 4COMQCh. 19.5 - An advantage of translesion-replicating...Ch. 19 - Is each of the following mutations a transition,...Ch. 19 - Prob. 2CONQCh. 19 - What does a suppressor mutation suppress? What is...Ch. 19 - Prob. 4CONQCh. 19 - X-rays strike a chromosome in a living cell and...Ch. 19 - Prob. 6CONQCh. 19 - Prob. 7CONQCh. 19 - 8. A point mutation occurs in the middle of the...Ch. 19 - Prob. 9CONQCh. 19 - Prob. 10CONQCh. 19 - 11. Is a random mutation more likely to be...Ch. 19 - 12. Which of the following mutations could be...Ch. 19 - Prob. 13CONQCh. 19 - Discuss the consequences of a germ-line versus a...Ch. 19 - Prob. 15CONQCh. 19 - Explain how a mutagen can interfere with DNA...Ch. 19 - What type of mutation (transition, transversion,...Ch. 19 - Explain what happens to the sequence of DNA during...Ch. 19 - Distinguish between spontaneous and induced...Ch. 19 - Prob. 20CONQCh. 19 - Prob. 21CONQCh. 19 - Prob. 22CONQCh. 19 - Trinucleotide repeat expansions (TNREs) are...Ch. 19 - 24. With regard to TNRE, what is meant by the term...Ch. 19 - 25. What is the difference between the mutation...Ch. 19 - Achondroplasia is a rare form of dwarfism. It is...Ch. 19 - Prob. 27CONQCh. 19 - In the treatment of cancer, the basis for many...Ch. 19 - Prob. 29CONQCh. 19 - 30. Which of the following examples is likely to...Ch. 19 - Prob. 31CONQCh. 19 - Prob. 32CONQCh. 19 - Prob. 33CONQCh. 19 - With regard to the repair of double-strand breaks,...Ch. 19 - Prob. 35CONQCh. 19 - Prob. 36CONQCh. 19 - 37. Three common ways to repair changes in DNA...Ch. 19 - Prob. 38CONQCh. 19 - Prob. 39CONQCh. 19 - Explain how the technique of replica plating...Ch. 19 - 2. Outline how you would use the technique of...Ch. 19 - 3. From an experimental point of view, is it...Ch. 19 - Prob. 4EQCh. 19 - Prob. 5EQCh. 19 - 6. Richard Boyce and Paul Howard-Flanders...Ch. 19 - In E. coli, a variety of mutator strains have been...Ch. 19 - 2. Discuss the times in a person’s life when it is...Ch. 19 - A large amount of research is aimed at studying...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- For the chromatogram below, what is the sequence of the template DNA from base 115 to 125? CTGTGTGAAA TTGT TA T C CGC T CACA A T TCCACA CA A CATACGAG CCGGAAG CA T AA 110 120 130 140 150 160 СТТТААСАAТА ТАTTCAATTТС ATAACAATTTC GAAATTGTTATarrow_forwardResearchers are designing several experiments to test the ability of Salmonella bacteria to develop antibiotic resistance. A culture of Salmonella bacteria is exposed to the same concentrations (200 mg/L) of an antibiotic for four days. The table shows the number of isolated resistant bacteria over a four-day period. Which of the following statements best explains these results? A - The bacteria were not affected by the antibiotic. B - After being exposed to the antibiotic, the bacteria altered their DNA. C - A new species of bacteria emerged after the antibiotics were introduced. D - Random mutations led some bacteria to be resistant and, over time, they increased in the population.arrow_forwardYou have 2 solutions of DNA. Solution 1 contains single stranded viral DNA while Solution 2 has double stranded form of the same viral DNA. Both solutions contain 1 mg/ml of DNA. You then expose each of these solutions to UV light at 260 nm. Which of the following results would you expect to see after UV light exposure? a.Neither solution will absorb any UV light but the DNA in both solutions will be broken by the action of the UV light. b.Solution 1 will absorb less light than Solution 2 c.Solution 1 will absorb more light than solution 2. d.Nothing will occur. DNA can only absorb UV light if it is interchelated with ethidium bromide. e.Both solutions will absorb the same amount of light since their concentrations are the same.arrow_forward
- To prepare a sample for electrophoresis, samples of the DNA being investigated (a) are put into each of four tubes and induced to replicate (b). Also, into the first tube, an adenine terminator was added in addition to all the other nucleotides. As the complementary strand was being constructed, the terminators were occasionally incorporated wherever an adenine nucleotide was used. This random incorporation resulted in all possible lengths of DNA pieces that had an adenine on the end (c). The same process was conducted in the other tubes with thymine, guanine and cytosine terminators; one treatment for each of the four lanes in the gel. Electrophoresis separated the replicated pieces of DNA by size. Staining the gel revealed which lengths of the complementary DNA were terminated by which nucleotide terminators (d). The gel consists of four “lanes,” labeled A, T, G, and C, indicating either adenine, thymine, guanine, or cytosine terminated pieces of DNA. By “reading” down the gel, you…arrow_forwardWhy was it necessary to mash the strawberries extensively with your hands? (hint: you wouldn’t have to do this step with an animal cells). Why do we treat the cells with soap when conducting DNA extraction? And why do we add salt when doing the DNA extraction?arrow_forwardThere are 2 parts to this question: The following DNA strand (below) is about to undergo DNA replication. a) Please replicate the parental strands into two exact copies TC GATATCGG AGCTATAGCC b) place a centromere between the two replicated copies (or tell me where the centromere would be located),arrow_forward
- Take each of the DNA sequences and complete ALL of the following steps: i. Find the DNA Replication Complement of each strand ii. Transcribe the complement strand of DNA into an mRNA strand Translate the mRNA strand into an Amino Acid strand iii. a. ATGGACGTATAGATGACAGGTAGATGTTTCAGGGGGATTTATCGATAG b. ATGGCCATTGAGTGTCAAAAGTCTCAATGA First base U UUU UUC UUA UUG CUU CUC C CUA CUG G U -phenylalanine (Phe) -leucine (Leu) GUU GUC GUA GUG leucine (Leu) AUU AUC isoleucine (lle) Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Second base ACU ACC AUA ACA AUG methionine (Met) (start) ACG -valine (Val) UCU UCC UCA UCG CCU CCC CCA CCG GCU GCC GCA GCG C -serine (Ser) -proline (Pro) -threonine (Thr) -alanine (Ala) UAU UAC UAA stop UAG stop CAU CAC CAA CAG AAU AAC AAA AAG A -tyrosine (Tyr) GAU GAC GAA GAG - histidine (His) -glutamine (Gln) - asparagine (Asn) -lysine (Lys) -aspartic acid (Asp) -glutamic acid (Glu) CGU CGC CGA CGG AGU AGC AGA AGG G -cysteine…arrow_forwardThere are 6 parts to this question: This is a follow up to the prior question regarding the replication of the DNA strand below. The DNA strand is here for your reference and you do not need to do anything with or to it. TC GATATCGG AGCTATAGCC c) what enzyme separated the parental DNA template strands, d) what bonds were broken? e) what enzyme replicates DNA f) before DNA can be replicated/copied, what must be laid down to allow the enzyme in "e" to replicated the DNA (be specific)? g) our DNA is replicated in many "pieces", what enzyme connects these many "pieces" into one continuous DNA strand that becomes the sister chromatid? h) during what specific phase of the cell cycle does this DNA replication process occur? (This should be a review question from last topics we covered).arrow_forwardYou have the following DNA sequence: 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. If the G that is underlined changes to to a C the result will be - A) A nonsenese mutation B) A frameshift mutation C) A silent substitution D) A missense mutation You have the following DNA sequence: 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. If the G that is underlined is deleted, then the result will be A) A nonsense mutation B) A frameshift mutation C) A silent substitution D) A missense mutatio If there are 3000 bases in the coding region of a gene, the gene will have A) 3000 amino acids B) 6000 amino acids C) 1000 amino acids D) 3000 codonsarrow_forward
- Look at the double-stranded segment of DNA shown below. Imagine that the two strands have already been denatured, and the temperature has been decreased to an appropriate annealing temperature. Show where the two primers would anneal to the strands, then indicate the direction of extension on each new strand with an arrow. 5’--T C A G G A C G T A A G C T T G C A T A T C T C G A T G C T A A A T C A T—3’ 3’--A G T C C T G C A T T C G A A C G T A T A G A G C T A C G A T T T A G T A—5’ Primer #1: 3’ A C G A T T T 5’ Primer #2: 5’ G G A C G T A 3’arrow_forwardYou have two tubes, each with a pair of DNA fragments inside them. Tube #1 has fragments that are 500bp and 1000 bp in length. Tube #2 has fragments that are 7500bp and 8000bp in size. If you were to perform agarose gel electrophoresis and run the contents of each tube in two separate lanes on the same gel, what would you expect to see? O That the difference between the distances migrated by the two fragments in Tube #1 was much greater than the difference between the distances migrated by the two fragments in Tube #2. O That the difference between the distances migrated by the two fragments in Tube #1 was the same as difference between the distances migrated by the two fragments in Tube #2. O That the difference between the distances migrated by the two fragments in Tube #1 was much less than the difference between the distances migrated by the two fragments in Tube #2. O It is not possible to estimate what we would expect to see.arrow_forwardDNA molecules of different sizes are often separated with the use of a technique called electrophoresis . With this technique, DNA molecules are placed in a gel, an electrical current is applied to the gel, and the DNA molecules migrate toward the positive (+) pole of the current. What aspect of its structure causes a DNA molecule to migrate toward the positive pole?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License