Genetics: Analysis and Principles
6th Edition
ISBN: 9781259616020
Author: Robert J. Brooker Professor Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Videos
Question
Chapter 19, Problem 29CONQ
Summary Introduction
To review:
The mutagen among the UV (ultraviolet) light, 5-bromourcil, and proflavin that caused a lysine codon to change into a glutamic acid codon.
Introduction:
Physical agents and chemical agents can act as extracellular substances that can induce mutations in the DNA (deoxyribonucleic acid) sequence of a cell, which are inherited by the daughter cells arising from that cell’s division. The mutations caused by these agents could be beneficial, detrimental, or have no effect on a cell.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Two possible point mutations are the substitution of lysine for leucine or the substitution of serine for threonine. Which is likely to be more serious and why?
For the given mutation below,please write down the reverse mutation and any intragenic suppressor mutations for that mutation. Use the codon table for amino acids as reference. In this case, mutation means single letter change.
Mutation: AGA -> AGC
Arg codons: CGU, CGC, CGA, CGG,AGA,ACG
Ser codons: UCU, UCC, UCA, UCG, AGU, AGC
Character limit is 10 characters. Write down Reverse mutation sequence first and then intragenic suppressor mutation sequence. Write down the mutated sequence not the mutation.
Several common antibiotics affect some strains of bacteria's ability to carry out transcription and/or translation. For example:
Rifamycin inhibits prokaryotic RNA polymerase
Chloramphenicol blocks the transfer of the peptide from the P to A site.
a) For each of these drugs, identify at what point it could affect the process of DNA->RNA->protein. Be as specific as possible.
b) Why do you think these drugs kill bacteria but spare animal cells? (Hint: remember bacteria are prokaryotes)
Chapter 19 Solutions
Genetics: Analysis and Principles
Ch. 19.1 - 1. A mutation changes a codon that specifies...Ch. 19.1 - A down promoter mutation causes the promoter of a...Ch. 19.1 - 3. A mutation in one gene that reverses the...Ch. 19.1 - Which of the following is an example of a somatic...Ch. 19.2 - Prob. 1COMQCh. 19.3 - Which of the following is not an example of a...Ch. 19.3 - A point mutation could be caused by a....Ch. 19.3 - One way that TNRE may occur involves the formation...Ch. 19.4 - Nitrous acid replaces amino groups with keto...Ch. 19.4 - Prob. 2COMQ
Ch. 19.4 - Prob. 3COMQCh. 19.5 - The function of photolyase is to repair a....Ch. 19.5 - Which of the following DNA repair systems may...Ch. 19.5 - 3. In nucleotide excision repair in E. coli, the...Ch. 19.5 - Prob. 4COMQCh. 19.5 - An advantage of translesion-replicating...Ch. 19 - Is each of the following mutations a transition,...Ch. 19 - Prob. 2CONQCh. 19 - What does a suppressor mutation suppress? What is...Ch. 19 - Prob. 4CONQCh. 19 - X-rays strike a chromosome in a living cell and...Ch. 19 - Prob. 6CONQCh. 19 - Prob. 7CONQCh. 19 - 8. A point mutation occurs in the middle of the...Ch. 19 - Prob. 9CONQCh. 19 - Prob. 10CONQCh. 19 - 11. Is a random mutation more likely to be...Ch. 19 - 12. Which of the following mutations could be...Ch. 19 - Prob. 13CONQCh. 19 - Discuss the consequences of a germ-line versus a...Ch. 19 - Prob. 15CONQCh. 19 - Explain how a mutagen can interfere with DNA...Ch. 19 - What type of mutation (transition, transversion,...Ch. 19 - Explain what happens to the sequence of DNA during...Ch. 19 - Distinguish between spontaneous and induced...Ch. 19 - Prob. 20CONQCh. 19 - Prob. 21CONQCh. 19 - Prob. 22CONQCh. 19 - Trinucleotide repeat expansions (TNREs) are...Ch. 19 - 24. With regard to TNRE, what is meant by the term...Ch. 19 - 25. What is the difference between the mutation...Ch. 19 - Achondroplasia is a rare form of dwarfism. It is...Ch. 19 - Prob. 27CONQCh. 19 - In the treatment of cancer, the basis for many...Ch. 19 - Prob. 29CONQCh. 19 - 30. Which of the following examples is likely to...Ch. 19 - Prob. 31CONQCh. 19 - Prob. 32CONQCh. 19 - Prob. 33CONQCh. 19 - With regard to the repair of double-strand breaks,...Ch. 19 - Prob. 35CONQCh. 19 - Prob. 36CONQCh. 19 - 37. Three common ways to repair changes in DNA...Ch. 19 - Prob. 38CONQCh. 19 - Prob. 39CONQCh. 19 - Explain how the technique of replica plating...Ch. 19 - 2. Outline how you would use the technique of...Ch. 19 - 3. From an experimental point of view, is it...Ch. 19 - Prob. 4EQCh. 19 - Prob. 5EQCh. 19 - 6. Richard Boyce and Paul Howard-Flanders...Ch. 19 - In E. coli, a variety of mutator strains have been...Ch. 19 - 2. Discuss the times in a person’s life when it is...Ch. 19 - A large amount of research is aimed at studying...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- A gene contains the sequence CGCATACGGTAC that results in the amino acid sequence arg-ile-arq- tyr. A mutation in this gene has a G inserted after the second C in the strand. How will this mutation affect the phenotype? A)This will affect the phenotype because although most of the protein will be identical, the first amino acid will be different. B)This will not affect the phenotype because only the second amino acid is different from the original protein. C)This will not affect the phenotype because the protein will be identical to the original protein. D)This will affect the phenotype because all of the amino acids after the first one will be different from the original protein.arrow_forwardIf the following nucleotide sequence represents the active domain of the COVID19’s M-protein 5’ ---- 5’ GGGUACAUGGUAGCCCCCGUCGAGAAAACACCC …. 3’ a) describe a potential mutation that may occur and the mechanism that could fix it b) if the repair mechanism is faulty, explain the consequences for COVID19 & that of the infected individualarrow_forwardHelp me pleasearrow_forward
- Consider the tryptophan codon 5′ - UGG - 3′ in the standard genetic code . Can a single base change in this codon create a synonymous mutation? Can a single base change in this codon create a nonsense codon?arrow_forwardIndicate whether the following sentences is either True or False and CORRECT the wrong sentences ( please answer the two questions 1 and 2) : 1. People having defective APC gene are more susceptible to developing polyps (benign tumors) in the colon, and such APC mutations can arise spontaneously or be triggered by environmental mutagens. 2. Monomeric α-catenin binds strongly to E-cadherin-β-catenin; and the dimer binds to intergrins .arrow_forwardConsider the now dominant variant of the SARS-CoV-2 called the D614G mutation: a) The mutation changes an Aspartate (D, Asp) to a Glycine (G, Gly) at nucleotide position 614 (that’s why it’s called the D614G mutant) in the S1 subunit of the Spike protein. Using only the information above and a codon table, what are the mRNA codon sequences of the 2019-dominant and 2020-dominant Spike proteins? Note the figure above is not needed toanswer the question. Report in 5’ to 3' orientation __________________________________________ b) What type of substitution is this? In your answer, address the following: • The expected substitution in base sequence (e.g., A à C)• If the mutation is synonymous, nonsynonymous, or a frameshift• If the mutation is a transition or a transversion c) The mutation increases infectivity by reducing the stability of the Spike protein such that it can remain in the open conformation more often. The open conformation increases the chances of binding to the host ACE2…arrow_forward
- Identify the following mutations and describe what the possible effect on the protein will be. (4) 5’GAT TTT AGC TTA GCC CAT 3’ 5’ GAT TAG CTT AGC CCA T 3’ 3’CTA AAA TCG AAT CGG GTA 5’ 3’ CTA ATC GAA TCG GGT A 5’ 5’ GAT TTT AGC TTA CCC CAT 3’ 5’ GAT TTT AGC TAA CCC CAT 3’ 3’ CTA AAA TCG AAT GGG GTA 5’ 3’ CTA AAA TCG ATT GGG GTA 5’arrow_forwardWhich of the following mutations in the protein-coding region of a gene is more likely to lead to complete loss of function of the encoded protein: an insertion of six nucleotides or a deletion of two nucleotides? Briefly explain your answer.arrow_forwardSilent mutations that occur in DNA are quite common in living cells and usually involve no effects on phenotype. In not more than 2 pages (using 1.5 line space of Arial or Times New Roman fonts) provide answers for the following questions? 1) Define the silent mutation in DNA? 2) What is the codon usage bias? 3) Provide one example of a clinical implication of a “silent mutation” that proven to have an effect on the phenotype andprovide a brief description of its molecular characteristics? (Explain in details)arrow_forward
- Silent mutations that occur in DNA are quite common in living cells and usually involve no effects on phenotype. In not more than 2 pages (using 1.5 line space of Arial or Times New Roman fonts) provide answers for the following questions? 1) Define the silent mutation in DNA? 2) What is the codon usage bias? 3) Provide one example of a clinical implication of a "silent mutation" that proven to have an effect on the phenotype and provide a brief description of its molecular characteristics?arrow_forwardSilent mutations that occur in DNA are quite common in living cells and usually involve no effects on phenotype. In not more than 2 pages (using 1.5 line space of Arial or Times New Roman fonts) provide answers for the following questions? 1) Define the silent mutation in DNA? 2) What is the codon usage bias? 3) Provide one example of a clinical implication of a “silent mutation” that proven to have an effect on the phenotype andprovide a brief description of its molecular characteristics?arrow_forwardBased on the following wild type DNA sequence, indicate if each of the mutations should be classified as : insertion, deletion, missense, nonsense, silent (Use the provided Genetic Code table and remember you have been given DNA sequence). Wild Type: 5’ ATG GCT AGA GTC GAG TTG 3’ Mutant 1: 5’ ATG GCA GAG TCG AGT TG 3’ Mutant 2: 5’ ATG GCT TGA GTC GAG TTG 3’ Mutant 3: 5’ ATG GCT AGA GTT GAG TTG 3’ Mutant 4: 5’ ATG GCT AGA AGT CGA GTT G 3’ Mutant 5: 5’ ATG GCT AGA ATC GAG GTT 3’arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
What are Mutations and what are the different types of Mutations?; Author: Science ABC;https://www.youtube.com/watch?v=I16YlE8qTBU;License: Standard youtube license