Take each of the DNA sequences and complete ALL of the following steps: i. Find the DNA Replication Complement of each strand Transcribe the complement strand of DNA into an mRNA strand Translate the mRNA strand into an Amino Acid strand a. ATGGACGTATAGATGACAGGTAGATGTTTCAGGGGGATTTATCGATAG b. ATGGCCATTGAGTGTCAAAAGTCTCAATGA

Q: Make a quick list of four dishes, of which one is made with vegetables that you had for your meal…

A: Salad (made with vegetables)Grilled chickenRice pilafGlass of red wine (alcohol after the…

Q: What effect would a continuous supply of exogenous estrogen or progesterone have on an adult female…

A: Estrogen and progesterone are two hormones that play important roles in the female reproductive…

Q: decompose material, this role could also be described as its

A: A living being is generally referred to as an organism. Despite having numerous independent pieces,…

Q: Activation of which 3 proteins would inhibit mTOR?  a. AMPK b. TSC c. PKA d. PTEN e. Akt

A: The mTOR (mammalian target of rapamycin) pathway is a crucial signaling pathway involved in…

Q: 7 A-C

A: The T4 bacteriophage is a distinct virus affecting Escherichia coli (E. coli) bacteria. It belongs…

Q: Determine the complementary DNA strand that would form. Next, write the mRNA that would form from…

A: DNA or deoxyribonucleic acid is a double stranded helical macromolecule that is composed of…

Q: During one of the genetics lab, you notice a few Drosophila fruit fly that has a rainbow body.  You…

A: In this case, hereditary crosses and offspring examinations are required to discover the strategy of…

Q: 2. GTPYS is a non-hydrolysable analogue of GTP. Predict the consequences of using GTPYS in the cell…

A: GTPγS (guanosine 5'-[γ-thio]triphosphate), are commonly used in experimental settings to study G…

Q: The following is a high-risk area. Discuss the opportunities for the risk management team to help…

A: Surgery and anesthesia. They can be unsafe since they're exceptionally complicated and the…

Q: Which of the following tools should be used in identifying a mutation in a sequence compared to a…

A: Gene mutations, and alterations in the DNA sequence, play a fundamental role in shaping life and…

Q: What do you call the site of activators that bind to the DNA molecule ? A. enhancer B. operon C.…

A: An important regulatory component in the regulation of gene expression is the location where…

Q: 아 70 60 50 4000 3297 3296 3072 2997 2996 3000 Wavenumber [cm-11 2000 1635 1630 1536 1447 1448 1534…

A: FTIR is used in understanding and identifying organic, inorganic and polymeric compounds in a given…

Q: An afterimage is a visual experience that can be explained by combining. principle of trichromatic…

A: An afterimage is a visual experience where a person continues to see an image after the original…

Q: Nerve fibers Blood vessel Axon Myelin sheath Blood vessels Ⓒ Thalamus Free nerve endings (pain,…

A: Sensory ascending pathways are neural pathways that transmit sensory information from the peripheral…

Q: 1. What are the most probable genotypes of individuals II-9 and II-10 2. If individuals II-1 and…

A: The pedigree shown in the question above has a pattern of inheritance for an uncommon human disease.…

Q: Describe a plate (NA plate with E. coli and chloroform-treated sewage) with plaques in the isolation…

A: Bacteriophages often known as phages  are the viruses that attack and spread throughout bacterial…

Q: Research a microbe that is not native to Pennsylvania - state its location, reservoirs, symptoms,…

A: Less than 1% of bacteria, for instance, are hazardous germs that may enter human bodies (the host)…

Q: Which of the following statements are true about protein in the diet? High protein diets have not…

A: Protein is an essential macronutrient that plays a crucial role in maintaining overall health and…

Q: Matching The following are lists of adult or “advanced” embryonic structures (1-20) and their…

A: The development of complex structures in the human body is a remarkable process that involves the…

Q: Carbon monoxide (CO) is toxic to humans because it:       A)  is rapidly converted to toxic CO2.…

A: Poisonous gas carbon monoxide (CO) is a serious risk to people's health. It is formed when carbon…

Q: List three conditions for which gene therapy trials have been performed for, and suggest reasons for…

A: Hemophilia is a genetic bleeding disorder caused by deficiencies in clotting factors most commonly…

Q: A doctor has ordered 450 mg of morphine be administered intravenously to a patient. Given that you…

A: In laboratory purposes and medical procedures, stock solutions play an important role in determining…

Q: You do a testcross to map three genes, Ph, T, and Qc. In the table below, you will find the number…

A: A test cross is a breeding experiment performed in genetics to determine the genotype of an…

Q: Homologies Both mammals and birds are descendants of ancestral reptiles. Meaning, they both…

A: Analogous structures are biological structures with similar functions that arose independently in…

Q: When placed in the same habitat, Paramecium aurelia will replace Paramecium caudatum. This is an…

A: Competitive exclusion, also known as the competitive exclusion principle, states that two species…

Q: The Fab regions of an antibody are made of which protein chain?       A)  a heavy chain containing…

A: Antibodies also known as immunoglobulins are proteins produced by immune cells called B cells. Each…

Q: What role is a wolf playing when it eats a rabbit that eats grass on a prairie in Wisconsin? Group…

A: The different steps in a nutritive series or food chain where the food in the form of energy…

Q: Create a pedigree with the following information on a family with colorblindness carried in their…

A: A hereditary disorder known as colour blindness inhibits a person's capacity to perceive and…

Q: If one side of the helix is CACTGGACTGTG, the complementary side would be??

A: There are two types of nucleic acids present in our body, DNA and RNA. DNA is the genetic material…

Q: Maternal and zygotic mRNAs regulate embryonic development by determining major body axes. Two of the…

A: In the process of embryonic development, maternal and zygotic mRNAs play a crucial part in…

Q: In the arterial blood of a healthy person, the quantity of CO2 dissolved in solution is  a. less…

A: The oxygenated blood that circulates through the pulmonary veins, the left chambers of the heart,…

Q: The phosphorylation and oxidative decarboxylation of oxaloacetate by inorganic phosphate (Pi) to…

A: In biochemical processes, the energetics of reactions play a crucial role in determining their…

Q: Place these organs in the correct order as they are located in the ruminant. Rumen Omasum > >…

A: Ruminants, such as cows, sheep, and goats, possess a unique digestive system that sets them apart…

Q: which of the following are the roles of proteins. select all that apply. - nutrient transport…

A: Proteins are large, complex molecules made up of amino acids. They are essential macromolecules…

Q: A serotonin can bind to ___. A. All nuerotransporters B. Serotonin and glutamate receptors since…

A: Serotonin is an essential neurotransmitter and hormone that affects many physiological and mental…

Q: As a general rule, for each jump up in trophic level, about how much does the available energy drop?…

A: According to the thermodynamic principle, the energy cannot be created nor destroyed, rather it is…

Q: bioenergetics of aerobic and anaerobic glucose oxidation, Pasteur effect.

A: Note: As per the bartleby guidelines the expert has to answer only the first question, if the…

Q: In a certain ecosystem, field mice are preyed on by snakes and hawks. The entry of wild dogs into…

A: Ecological systems are composed of complex interactions between organisms and their environment.…

Q: An individual’s skeletal remains were found displaying the following list of traits: Rounded eye…

A: Skeletal remains can provide valuable insights into an individual's ethnic origin and sex. By…

Q: Consider a mutant of E. coli that has an inactivating mutation in the gene for the catabolite…

A: The lac operon is a negatively inducible operon.

Q: 2. List a mixture of three substances that could be separated my similar means to the ones in this…

A: There are various methods to separate different substances that are mixed. The separation depends on…

Q: The Lazy River Environmental Group organized a major cleanup of the pollution from the old factory…

A: The statement that describes the results of the clean up is There was a one-third drop in pollutant…

Q: Derive the rate law for the following enzyme reaction chain. Linear the equation you have derived as…

A: Rate law is the rate of chemical…

Q: 4. Describe and give an example of each of the following: a. Commensalism b. Mutualism c. Parasitism

A: Commensalism is a symbiotic relationship in which one organism benefits, while the other is neither…

Q: You start a cross with a true-breeding red-eyed troll and a true-breeding white-eyed troll, and then…

A: Trait is a characteristic feature that is unique to particular individual. Each trait is illustrate…

Q: Predict the growth/color pattern you'd expect for constitutive mutants for the lac operon. Table 1:…

A: A group of genes in bacteria called the lac operon are in charge of lactose processing. The lacZ…

Q: 1. If gene transcription is inhibited after fertilization, development past the two-cell stage does…

A: Embryology - It is the study of the development of the embryo of any organism. In this question the…

Q: 5. - In a paragraph Describe the role of non-specific macrophages in preventing infection. (150…

A: A macrophage is a type of white blood cell that aids the immune system in its fight against…

Q: Why do you think science is an important field of study?  How does science impact our day to day…

A: Science has a role in ensuring better times for future generations through researching the effects…

Q: 1. Compare the consequences of a mutation that occurs in the Ras proto-oncogene and a mutation that…

A: Mutations in key genes can have profound effects on cellular processes, particularly when they…

Viral Replication

The virus is acellular and considered non-living outside the host cell. The replication of the virus occurs only inside the living cells. Only a few genes are present in the smallest virus, whereas many genes are present in the largest virus. These genes encode specific viral proteins.