Genetics: From Genes to Genomes
6th Edition
ISBN: 9781259700903
Author: Leland Hartwell Dr., Michael L. Goldberg Professor Dr., Janice Fischer, Leroy Hood Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 14, Problem 29P
Streptococcus parasanguis is a bacterial species that initiates dental plaque formation by adhering to teeth. To investigate ways to eliminate plaque, researchers constructed a plasmid, depicted in the figure shown, to mutagenize S. parasanguis. The key features of this plasmid include repts A (a temperature-sensitive origin of replication), kanr (a gene for resistance to the antibiotic kanamycin), and the transposon IS256. This transposon contains the erm gene for resistance to the antibiotic erythromycin. IS256 transposes in S. parasanguis thanks to a gene encoding a transposase enzyme that moves all DNA sequences located between the transposon’s inverted repeats (IRs).
| a. | How could the researchers use this plasmid as a mutagen? Consider how they could get the transposon into the bacteria, and how they could identify strains that had new insertions of IS256 into S. parasanguis genes. Your answer should explain why the plasmid has two different antibiotic resistance genes as well as a temperature-sensitive origin of replication. |
| b. | Why would the researchers use this plasmid as a mutagen? |
| c. | If the investigators found a mutant strain of S. parasanguis that was defective in plaque formation, how could they identify the affected gene? |
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Xeroderma pigmentosum is a genetic disease caused by an error in the nucleotide excision repair process that fixes damage to DNA by ultraviolet light. Studies have shown that it can result from mutations in any one of seven genes. What can you infer from this finding?
A) There are seven genes that produce the same protein
B) These seven genes are the most easily damaged by ultraviolet light.
C) There are seven enzymes involved in the nucleotide excision repair process.
D) These mutations have resulted from translocation of gene segments.
With reference to the image below, discuss the process and principle involved for screening/selection of hosts (last stage of cloning) containing the intended recombinant plasmid.
LacZ' = Gene for alpha-peptide of β-galactosidase.
A plasmid, pUC18, contains the ampicillin-resistance gene, the origin of replication, and the ß -
gal gene, which codes for the B-galactosidase protein. This protein can break down the synthetic
chemical X-gal, producing a blue product that stains the entire cell blue (but is harmless to the
bacteria). At the beginning of the B-gal gene there are several unique restriction sites (some of
them are shown in the diagram below). You wish to clone a 1.0-kb Xbal fragment into the pUC18
plasmid, so you cut the plasmid with Xbal and, after removing the enzyme, mix the Xbal-cut
plasmid with the 1.0-kb fragment, ligate, and transform competent bacteria.
Pati
Xbal
EcoRI
B-gal
A
Amp
ori
Figure: pUC18 plasmid map
(a) On what medium would you grow your transformed bacteria?
(b) Do you expect the bacteria carrying plasmid pUC18 (without the insert) to be blue or white
when grown in the presence of X-gal? Explain.
Chapter 14 Solutions
Genetics: From Genes to Genomes
Ch. 14 - Choose the phrase from the right column that best...Ch. 14 - The unicellular, rod-shaped bacterium E. coli is 2...Ch. 14 - Now that the sequence of the entire E. coli K12...Ch. 14 - Bacterial genomes such as that of E. coli...Ch. 14 - List at least three features of eukaryotic genomes...Ch. 14 - Describe a mechanism by which a gene could move...Ch. 14 - High salt concentrations tend to cause protein...Ch. 14 - Recently, scientists tested the possibility that...Ch. 14 - A recent metagenomic study analyzed the...Ch. 14 - Linezolid is a new type of antibiotic that...
Ch. 14 - A liquid culture of E. coli at a concentration of...Ch. 14 - Pick out the medium i, ii, iii, or iv onto which...Ch. 14 - This problem concerns Fig. 14.14, which...Ch. 14 - In two isolates one is resistant to ampicillin,...Ch. 14 - E. coli cells usually have only one copy of the F...Ch. 14 - In E. coli, the genes purC and pyrB are located...Ch. 14 - DNA sequencing of the entire H. influenzae genome...Ch. 14 - Genes encoding toxins are often located on...Ch. 14 - a. You want to perform an interrupted-mating...Ch. 14 - In Problem 19, do you think that most of the...Ch. 14 - One issue with interrupted-mating experiments such...Ch. 14 - Prob. 22PCh. 14 - Starting with an F- strain that was prototrophic...Ch. 14 - You can carry out matings between an Hfr and F...Ch. 14 - Genome sequences show that some pathogenic...Ch. 14 - Generalized and specialized transduction both...Ch. 14 - This problem highlights some useful variations of...Ch. 14 - A researcher has a Trp auxotrophic strain of E....Ch. 14 - Streptococcus parasanguis is a bacterial species...Ch. 14 - The sequence at one end of one strand of the...Ch. 14 - Scientists who study amino acid biosynthesis...Ch. 14 - Suppose that you could obtain radioactively...Ch. 14 - Prob. 34PCh. 14 - Some scientists are trying to engineer...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Many resistance mechanisms are encoded on plasmids. These mechanisms are of great clinical significance, because they can spread very easily through horizontal gene transfer. A culture of the bacterial isolate is grown, and plasmid DNA is isolated using a spin column-based solid phase extraction method. The purified plasmid DNA is then submitted for next-generation sequencing. Bioinformatic analyses of the sequencing results suggests that the following gene is likely involved in antibiotic resistance: > putative antibiotic resistance gene ATGCGTGTATTAGCCTTATCGGCTGTGTTTTTGGTGGCATCGATT ATCGGAATGCCTGCGGTAGCAAAGGAATGGCAAGAAAACAAAAGT TGGAATGCTCACTTTACTGAACATAAATCACAGGGCGTAGTTGTG CTCTGGAATGAGAATAAGCAGCAAGGATTTACCAATAATCTTAAA CGGGCGAACCAAGCATTTTTACCCGCATCTAGTGCGAAAATTCCC AATAGCTTGATCGCCCTCGATTTGGGCGTGGTTAAGGATGAACAC CAAGTCTTTAAGTGGGATGGACAGACGCGCGATATCGCCACTTGG AATCGCGATCATAATCTAATCACCGCGATGAAATATTCAGTTGTG CCTGTTTATCAAGAATTTGCCCGCCAAATTGGCGAGGCACGTATG…arrow_forwardA shuttle vector is a vector (usually a plasmid) constructed so that it can propagate in two different host species. One of the most common types of shuttle vectors is the yeast shuttle vector. Examples of such vectors derived from yeast are Yeast Episomal Plasmid (YEP), Yeast Integrating Plasmid (YIP) and Yeast Replicating Plasmid (YRP). Why is YEP preferred over YIP and YRP? Give your thoughts on this.arrow_forwardA) Outline the experimental procedure for cloning a eukaryotic gene and expressing it in E. coli. Focus on the essential steps starting with eukaryotic gene amplification to transformation of E. coli cells B) Explain how insertional inactivation can help you identify the colonies that carry the plasmid with your eukaryotic gene of interest C) Plasmids containing antibiotic resistance genes are widely used in gene cloning and other molecular biology techniques. What would happen if the eukaryotic gene was inserted into an antibiotic resistance gene on the plasmid?arrow_forward
- Bacterial plasmids often serve as cloning vectors. Describe the essential features of a plasmid vector.arrow_forwardYou have set up a recombinant DNA experiment using the plasmid PBR322 as the vector (see plasmid below). You use the BamHI restriction site on the plasmid to insert the target DNA. The plasmid is then used to transform E.coli colls Is the following statement True or False? Growth of the transformed cells on agar containing both ampicillin and tetracycline will eliminate any cells that do not contain a plasmid. Clal Hindlll EcoRI Pvul BamHI Pstl amp tet PBR322 -Sall ori rop Pvull True Falsearrow_forwardIt is desired to isolate genomic DNA from liquid culture of S. cerevisiae yeast. A commercial kit will be used to isolate genomic DNA from this liquid culture. Answer the following questions to understand the strategy used by commercial kits for genomic DNA isolation. a) List all the steps from cell pellet preparation to DNA elution. b) With which feature can the membrane in the column that comes with the commercial kit bind DNA? c) Which component in the kit would you use to recover the DNA from the membrane of the column to which the DNA was attached?arrow_forward
- In bacterial transformation, the purpose of having antibiotic within an agar plate is to: Select one: confirm which plasmids been have successfully ligated with a gene of interest. isolate bacteria which have been successfully transformed with the plasmid. indicate which plasmids were successfully digested by the endonuclease. act as a substrate which will be cleaved and produce a blue product when ligation is unsuccessful. show which plasmids contain the lacZ gene.arrow_forwardConsider the following plasmid (size 8000 bp), with restriction sites at the positions indicated: (see image) a) This plasmid is digested with the enzymes listed below. Indicate how many fragments will begenerated in each case, and give the sizes of the fragments.PstIXhoICombination of PstI + XhoI + EcoRI (triple digest) b) Draw the banding pattern you would expect to observe if each of these digestions is loaded into a separate well of an agarose gel, and the fragments separated by electrophoresis. In the first well you load a DNA marker (M) containing fragments with sizes of 1000 bp, 2000 bp, 4000 bp and 8000 bp. c) This gel is transferred to a membrane in a Southern blot experiment, and hybridised to a radioactively labelled 200 bp probe, which anneals to the plasmid DNA at the position indicated on the diagram above. Draw the autoradiographic profile you would expect to observe for the membrane.arrow_forwardWe transformed E coli cells with a plasmid modified to contain a ‘virulence factor’ which would allow growth on media containing the antibiotic kanamycin (Kan). The plasmid confers constitutive resistance to ampicillin (Amp). The bacterial experiment is about understanding whether such a ‘virulence factor’ confers physiological adaptation to Kan or whether the development of resistance can be explained by random mutations. For each independent transformation we re-suspended the cells from three colonies in Luria broth. For each suspension of cells we plated 100 microliters on a Kan plate. To estimate the number of cells seeded on each Kan plate we made four serial dilutions that were plated on Amp plates (1 – 4) and we counted the number of cells growing on them. From this we extrapolated how many cells had been seeded on the Kan plate. Then we normalised the Kan results for all the plates, assuming that every plate had been seeded with 10[5] cells. Consider two Kan plates, each with…arrow_forward
- The following DNA sequence is from a bacteriophage that infects a pathogenic bacterium and scientists want to know if this bacteriophage could prove to be a potential treatment against it. But first scientists need to discover if different strains of this pathogen have restriction endonucleases that it may use for its own protection. They try 3 different RE’s:a) EcoR1 b) HaeIII c) BamH1 Look up the recognition sequences for the 3 Res. Enzymes above and check whether the phage genome (a snippet of which is shown below) will or will not be ‘cut’. Tell me how their experiment worked out and what their conclusion was.G A A A A G G C C A C A A G G C C G T C G A C T T T T A A A A G G C C A C A T G C G G C T T T T C C G G T G T T C C G G C AG C T GA A A AT T T T C C G G T G T A C G CCarrow_forwardThe genes for both the α- and βglobin chains of hemoglobin contain introns (i.e., they are split genes). How would this fact affect your plans if you wanted to introduce the gene for α-globin into a bacterial plasmid and have the bacteria produce α-globin?arrow_forwardIn relation to the use of restriction enzymes in recombinant DNA technology, answer the following: You have accidentally torn the labels off two tubes (tube A and tube B), each containing a different plasmid, now you do not know which plasmid is in which tube. Fortunately, you have restriction maps for both plasmids, shown in Figure below. You have the opportunity to test just one sample from one of your tubes. By utilizing agarose gel electrophoresis technique, which restriction enzyme OR combination of restriction enzymes would you use in this experiment to determine which plasmid is found in which tube?. (Hint: if you use Hind III restriction enzyme you are going to get ONE single fragment with a molecular size of → 0.5+0.3+0.2+0.4+1+1 = 3.4 kb).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license