Genetics: From Genes to Genomes
6th Edition
ISBN: 9781259700903
Author: Leland Hartwell Dr., Michael L. Goldberg Professor Dr., Janice Fischer, Leroy Hood Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 14, Problem 7P
High salt concentrations tend to cause protein aggregation. Suggest a way to identify proteins normally expressed in particular bacterial species that can retain their solubility despite high salt conditions.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Describe the function of the Bicoid protein. Explain how its ability to exert its effects in a concentration-dependent manner is a critical feature of its function.
How can you tell if a protein is stably expressed over time by looking at a pulse-chase analysis gel with bands?
Consider the structure of Cro repressor protein from bacteriophage lambda E. It is a DNA binding protein, and like many sequence-
specific DNA binding proteins, it must function as a homodimer Ex.
Notice the mutual docking of a phenylalanine residue from each subunit into a hydrophobic pocket of the partner subunit. These
hydrophobic interactions are required for dimerization.
The noncovalent interactions highlighted in yellow are also required for dimerization. These interactions represent examples of:
Osecondary structure
O tertiary structure
O quaternary structure
O secondary AND quaternary structure
Ⓒ tertiary AND quaternary structure
Chapter 14 Solutions
Genetics: From Genes to Genomes
Ch. 14 - Choose the phrase from the right column that best...Ch. 14 - The unicellular, rod-shaped bacterium E. coli is 2...Ch. 14 - Now that the sequence of the entire E. coli K12...Ch. 14 - Bacterial genomes such as that of E. coli...Ch. 14 - List at least three features of eukaryotic genomes...Ch. 14 - Describe a mechanism by which a gene could move...Ch. 14 - High salt concentrations tend to cause protein...Ch. 14 - Recently, scientists tested the possibility that...Ch. 14 - A recent metagenomic study analyzed the...Ch. 14 - Linezolid is a new type of antibiotic that...
Ch. 14 - A liquid culture of E. coli at a concentration of...Ch. 14 - Pick out the medium i, ii, iii, or iv onto which...Ch. 14 - This problem concerns Fig. 14.14, which...Ch. 14 - In two isolates one is resistant to ampicillin,...Ch. 14 - E. coli cells usually have only one copy of the F...Ch. 14 - In E. coli, the genes purC and pyrB are located...Ch. 14 - DNA sequencing of the entire H. influenzae genome...Ch. 14 - Genes encoding toxins are often located on...Ch. 14 - a. You want to perform an interrupted-mating...Ch. 14 - In Problem 19, do you think that most of the...Ch. 14 - One issue with interrupted-mating experiments such...Ch. 14 - Prob. 22PCh. 14 - Starting with an F- strain that was prototrophic...Ch. 14 - You can carry out matings between an Hfr and F...Ch. 14 - Genome sequences show that some pathogenic...Ch. 14 - Generalized and specialized transduction both...Ch. 14 - This problem highlights some useful variations of...Ch. 14 - A researcher has a Trp auxotrophic strain of E....Ch. 14 - Streptococcus parasanguis is a bacterial species...Ch. 14 - The sequence at one end of one strand of the...Ch. 14 - Scientists who study amino acid biosynthesis...Ch. 14 - Suppose that you could obtain radioactively...Ch. 14 - Prob. 34PCh. 14 - Some scientists are trying to engineer...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Many blood clotting proteins undergo a post-translational modification in which specific glutamic acid residues (Glu) in the protein are converted to gamma-carboxyglutamic acid residues (Gla). See reaction scheme below. An example is the blood clotting protein Factor IX, which has 12 Glu in its N-terminus converted to Gla. This modification gives Factor IX the ability to bind calcium and phospholipid membranes. Bacteria do not have the enzyme required to convert Glu to Gla and therefore Factor IX proteins expressed in bacteria would not have the proper modifications. How might you engineer the translational apparatus of a bacterial cell line so that it produces Factor IX with Gla in the appropriate positions. How would you ensure that only the 12 Glu in Factor IX that are normally converted to Gla and not just all Glu (Limit 5-6 senetnces)?arrow_forwardIn addition to in the information given in the pictures, researchers provide further descriptions for the figure stating: Players were also able to restructure b-sheets to improve hydrophobic burial and hydrogen bond quality. Automated methods have difficulty performing major protein restructuring operations to change b-sheet hydrogen-bond patterns, especially once the solution has settled in a local low-energy basin. Players were able to carry out these restructuring operations in such scenarios as strand swapping (Fig. 3) and register shifting. In one strand-swap puzzle, Foldit players were able to get within 1.1 A° of the native structure, with the top-scoring Foldit prediction being 1.4 A° away. A superposition between the starting Foldit puzzle, the top-scoring Foldit solution, and model 1 of the native NMR structure 2kpo (Protein Data Bank) are shown in Fig. 3b. Rosetta's rebuild and refine protocol, however, was unable to get within 2 A ° of the native structure (Fig. 3a, yellow…arrow_forward(c) By binding one L-tryptophan molecule/monomer, the trp repressor binds to DNA to suppress syn- thesis of L-tryptophan in E. coli. Below is the amino acid sequence of the helix – (reverse) turn – helix region of the trp repressor that binds to DNA compared to the sequence of the corresponding DNA binding motif of the Prl protein, a different type of repressor protein. A diagram of the trp repressor dimer is also shown. reverse turn trp helix 4 70 Trp -Gly-Glu-Met-Ser-Gln-Arg-Glu-Leu-Lys-Asn-Glu-Leu-Gly-Ala-Gly- Ile- Prl -Ser-Glu-Glu-Ala-Lys-Glu-Glu-Leu-Ala-Lys-Lys-Cys-Gly-Ile-Thr- Val- Pri heilix trp helix 5 80 90 Trp Ala-Thr-Ile-Thr-Arg-Gly-Ser sgn-Ser-Leu-Lys-Ala-Ala- Prl Ser-Gln-Val-Ser-Asn-Trp-Phe-Gly-Asn-Lys-Arg-Ile-Arg- Prl helixarrow_forward
- Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’- GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ By in vitro translating the mRNA, you determined that the translated peptide is 15 amino acids long. What is the expected peptide sequence in single letter abbreviations?arrow_forwardDuring periods of starvation, translation of only vital mRNAs must occur inside a cell. Explain how eIF2 can mediate both the suppression of translation of non-essential mRNAs and ensure that essential mRNAs continues to be translated.arrow_forwardIs there a difference in the effects of different salt solutions on protein denaturation? Why?arrow_forward
- In a mixed heteropolymer experiment, messages were createdwith either 4/5C:1/5A or 4/5A:1/5C. These messages yielded proteinswith the amino acid compositions shown in the followingtable. Using these data, predict the most specific coding compositionfor each amino acid.4/5C:1/5A 4/5A:1/5CPro 63.0% Pro 3.5%His 13.0% His 3.0%Thr 16.0% Thr 16.6%Glu 3.0% Glu 13.0%Asp 3.0% Asp 13.0%Lys 0.5% Lys 50.0% 98.5% 99.1%arrow_forwardA random-sequence polyribonudeotide produced by polynudleotide phosphorylase, with CDP and ADP in a 5:1 molar ratio stimulated the incorporation of proline, histidine, threonine, glutamine, asparagine, and ly- sine in a cell-free translation system in the following proportions: 100, 23.4, 20, 3.3, 3.3, and 1.0, respectively. What does this experiment reveal about the nucleotide composition of coding triplets for these six amino acids?arrow_forward. Explain why DNA is stable in the presence of alkali (0.3 M KOH), while RNA is quantitatively degraded to 2'- and 3'-nucleoside monophosphates under these conditions.arrow_forward
- Explain how catabolite repression depends on an activatorproteinarrow_forwardPlease do answer all the questions. I'll definitely give a like You discovered a halophilic bacterium and want to characterize the mechanism involved in producing mature tRNA molecules from larger tRNA precursors. You isolated a large complex composed of a protein component and an RNA component that is capable of cleaving the larger tRNA precursor. To determine which one of the two components is responsible for catalysis, you perform an in vitro tRNA cleavage assay in the proper buffer conditions, including a low concentration of Mg2+ and 0.5 M bovine serum albumin (BSA). BSA is not specific for this reaction. The table below summarizes the results after performing eight separate reactions. The + symbol indicates the included reaction components. Q. Based on the results obtained, what can you conclude about the composition of the biological catalyst required for the maturation of tRNA? Q. Indicate which reactions helped you make your conclusion. Why? Q. Which reactions allowed you…arrow_forwardThe steroid progesterone has an important role in the female reproductive system. Researchers interested in studying membrane progestin receptors (MPRS) developed a method to produce and purify the protein in active form. First, the researchers devised a way to prepare a specific MPR known as hMPRA using the machinery of yeast cells. In order to facilitate purification and identification in later studies, they manipulated the yeast cells so that they attached two different tags to the C-terminal end of the protein. The first tag, Compound 1, is a peptide sequence that acts as an epitope, part of a much larger peptide sequence that is recognized by the immune system. The second sequence consisted of six consecutive histidine residues (His). This sequence binds tightly to Ni2+ cations. In chromatography, (His), tag labeled proteins can be eluted from Ni²+. supported columns by adding a small molecule to the eluent that mimics the side chain of histidine.…arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
TISSUE REPAIR Part 1: Repair - Regeneration; Author: ilovepathology;https://www.youtube.com/watch?v=t-5EjlS6qjk;License: Standard YouTube License, CC-BY