Genetics: From Genes to Genomes
6th Edition
ISBN: 9781259700903
Author: Leland Hartwell Dr., Michael L. Goldberg Professor Dr., Janice Fischer, Leroy Hood Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 14, Problem 30P
The sequence at one end of one strand of the Drosophila transposon Mariner is shown below (dots indicate sequences within the transposon):
5′ TTAGTTTGGCAAATATCTCCCTTCCGCCTTTTTGATCTTATGT... 3′
You obtain a mutant bacterial strain tagged with an engineered Mariner transposon, cut the genomic DNA from this strain with the restriction enzyme MboI (whose recognition site is ^GATC), and circularize the resultant DNA fragments by diluting the restriction enzyme digest and adding DNA ligase.
| a. | Design two 17 bp PCR primers that you could use to identify (by inverse PCR) the gene into which the transposon inserted. |
| b. | What DNA sequence will be amplified from the circularized fragments of the mutant genome? Show the extent of this DNA sequence on a map of the genome of the mutant strain, indicating the locations of the transposon insertion and any relevant sites for the enzyme MboI. |
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
The DNA sequence of one strand of a gene from threeindependently isolated mutants is given here (5′ endsare at left). Using this information, what is the sequence of the wild-type gene in this region?mutant 1 ACCGTAATCGACTGGTAAACTTTGCGCGmutant 2 ACCGTAGTCGACCGGTAAACTTTGCGCGmutant 3 ACCGTAGTCGACTGGTTAACTTTGCGCG
The most common MCAD mutation is shown below. The coding strand is shown for both the WT and mutant. The TATA box and kozak sequences are in parenthesis. What type of mutation is present?
Wild-type:5’-ATGGCC[TATAT]ATGTCACTTGACTACGCAGCC[GCCACCATGG]ATATAGATAATGCGCGCATAGCATACTGAGGGTAGTAG-3’
Mutant:5’-ATGGCC[TATAT]ATGTCACTTGACTACGCAGCC[GCCACCATGG]ATATAGATAATGCGCGC AGAGCATACTGAGGGTAGTAG-3’
Answer: Is this a transition mutation? because there is an exchange of G instead of A? It kind of confuses me a little. help
Which of the following set(s) of primers a-d could you use to amplify the
following target DNA sequence, which is part of the last protein-coding exon of
the CFTR gene? Explain briefly. (Note: The three dots represent the body of the
region to be amplified, whose beginning and end are only being shown.)
5' GGCTAAGATCTGAATTTTCCGAG . TTGGGCAATAATGTAGCGCCTT 3'
3' CCGATTCTAGACTTAAAAGGCTC . AACCCGTTATTACATCGCGGAA 5'
a. 5' GGAAAATTCAGATCTTAG 3';
5' TGGGCAATAATGTAGCGC 3'
b. 5' GCTAAGATCTGAATTTTC 3';
3' ACCCGTTATTACATCGCG 5'
c. 3' GATTCTAGACTTAAAGGC 5';
3' АССCGTTATTАСАТСGCG 5
d. 5' GCTAAGATCTGAATTTTC 3';
5' TGGGCAATAATGTAGCGC 3'
Chapter 14 Solutions
Genetics: From Genes to Genomes
Ch. 14 - Choose the phrase from the right column that best...Ch. 14 - The unicellular, rod-shaped bacterium E. coli is 2...Ch. 14 - Now that the sequence of the entire E. coli K12...Ch. 14 - Bacterial genomes such as that of E. coli...Ch. 14 - List at least three features of eukaryotic genomes...Ch. 14 - Describe a mechanism by which a gene could move...Ch. 14 - High salt concentrations tend to cause protein...Ch. 14 - Recently, scientists tested the possibility that...Ch. 14 - A recent metagenomic study analyzed the...Ch. 14 - Linezolid is a new type of antibiotic that...
Ch. 14 - A liquid culture of E. coli at a concentration of...Ch. 14 - Pick out the medium i, ii, iii, or iv onto which...Ch. 14 - This problem concerns Fig. 14.14, which...Ch. 14 - In two isolates one is resistant to ampicillin,...Ch. 14 - E. coli cells usually have only one copy of the F...Ch. 14 - In E. coli, the genes purC and pyrB are located...Ch. 14 - DNA sequencing of the entire H. influenzae genome...Ch. 14 - Genes encoding toxins are often located on...Ch. 14 - a. You want to perform an interrupted-mating...Ch. 14 - In Problem 19, do you think that most of the...Ch. 14 - One issue with interrupted-mating experiments such...Ch. 14 - Prob. 22PCh. 14 - Starting with an F- strain that was prototrophic...Ch. 14 - You can carry out matings between an Hfr and F...Ch. 14 - Genome sequences show that some pathogenic...Ch. 14 - Generalized and specialized transduction both...Ch. 14 - This problem highlights some useful variations of...Ch. 14 - A researcher has a Trp auxotrophic strain of E....Ch. 14 - Streptococcus parasanguis is a bacterial species...Ch. 14 - The sequence at one end of one strand of the...Ch. 14 - Scientists who study amino acid biosynthesis...Ch. 14 - Suppose that you could obtain radioactively...Ch. 14 - Prob. 34PCh. 14 - Some scientists are trying to engineer...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The double stranded DNA sequence shown contains the promoter for the transcription of a bacterial gene. GGCACCTGCGATGCATGAATATATCGATCGGGAATCGCTATGTCAAGCCATGGCTAGATTA CCGTGGACGCTACGTACTTATATAGCTAGCCCTTAGCGATACAGTTCGGTACCGATCTAAT Draw a box around each of the promoter elements and identify each. Identify which strand will be used as the template strand by putting a vertical line between the -1/+1 start site nucleotides and underlining in the direction of transcription on the template strand as the example below indicates. ATCGG\GAATCGC TAGCCCTTAGCG Give the sequence of the RNA createdarrow_forwardBelow is a portion of an exon from a gene that encodes protein X in the genome of the plant Arabidopsis. Wildtype DNA3’ TTC AAT GCT CCG AAT ACC 5’ template strand5’ AAG TTA CGA GGC TTA TGG 3’ non-template strand A new strain (Strain B) of Arabidopsis is identified with the same region of the gene coding for protein X: 3’ TTC AAT GCT CCC AAT ACC 5’ template strand5’ AAG TTA CGA GGG TTA TGG 3’ non-template strand Compare the two DNA sequences and look for any differences. Based on what you find a. There is no mutation in Strain B compared to Strain A. b. After the point of the mutation, all the amino acids encoded by the Strain B template will be different than the Strain A protein X. c. Protein X made from the Strain B template will be much shorter than protein X made from the Strain A template d. Protein X from Strain B will have one amino acid difference that would not affect protein function. e. There is a mutation but there will not be any difference in the…arrow_forwardYou are studying a protein that contains the peptide sequence RDGSWKLVI. The part of the DNA encoding this peptide is included in the sequence shown below. 5'-CGTGACGGCTCGTGGAAGCTAGTCATC-3' 3'-GCACTGCCGAGCACCTTCGATCAGTAG-5' This sequence does not contain any BamHI restriction enzyme sites. The target sequence for the BamHI restriction nuclease is GGATCC. Your goal is to create a BamHI site on this plasmid by manipulating the DNA sequence, without changing the coding sequence of the protein. How would you do this, ie what would the new sequence be?arrow_forward
- For the DNA sequence shown, indicate the products of its cleavage with the following restriction endonucleases (AKA restriction enzymes):5′-ACAGCTGATTCGAATTCACGTT-3′3′-TGTCGACTAAGCTTAAGTGCAA-5′a) EcoRI (the recognition sequence and cleavage site is G↓AATTC);b) AluI (the recognition sequence and cleavage site is AG↓CT).arrow_forwardWhich of the following set(s) of primers a–d couldyou use to amplify the following target DNA sequence, which is part of the last protein-coding exonof the CFTR gene?5′ GGCTAAGATCTGAATTTTCCGAG ... TTGGGCAATAATGTAGCGCCTT 3′3′ CCGATTCTAGACTTAAAAGGCTC ... AACCCGTTATTACATCGCGGAA 5′a. 5′ GGAAAATTCAGATCTTAG 3′;5′ TGGGCAATAATGTAGCGC 3′b. 5′ GCTAAGATCTGAATTTTC 3′;3′ ACCCGTTATTACATCGCG 5′c. 3′ GATTCTAGACTTAAAGGC 5′;3′ ACCCGTTATTACATCGCG 5′d. 5′ GCTAAGATCTGAATTTTC 3′;5′ TGGGCAATAATGTAGCGC 3′arrow_forwardThe following table lists 4 bacterial strains that are partial diploids for lac operon genes. Given the activity of beta-galactosidase measured for each strain in the absence (-lac) or presence (+lac) of lactose, complete the table by choosing the appropriate symbol (+, -, C, S) to indicate the allele of the gene or site missing from the table (blue numbers). strain A BC 5 C D 7 chromosome I O 1 2 4 1 [Select] 9 3 [Select] [Select] [Select] 9 [Select] + + Z + + 6 + I +5 + 10 plasmid O 3 + 7 C Z + 8 8 2 [Select] 4 [Select] 6 [Select] B-gal act. -lac +lac 0.002 0.003 0.002 0.058 0.063 0.121 0.059 0.062 Select] 1 ✔ [ Select] + is C Sarrow_forward
- Below is a portion of an exon from a gene that encodes protein Y in the genome of the plant Brassica. Wildtype DNA3’ CTT AAT GCT CCG AAT CCA 5’ template strand5’ GAA TTA CGA GGC TTA GGT 3’ non-template strand A new strain (Strain X) of Brassica is identified with the same region of the gene coding for protein Y:3’ CTT AAT GCT GCG AAT CCA 5’ template strand5’ GAA TTA CGA CGC TTA GGT 3’ non-template strand Compare the sequence of Wildtype with Strain X DNA, and note the following: Whether there is a mutation. If there is a mutation, what is the type of mutation (be as specific as possible) and explain the rationale for your decision. Assuming this is the only difference between the Wildtype and Strain X, describe the potential impact of the mutation on the structure and function of the protein.arrow_forwardSuppose a researcher previously cloned gene Y into M13 bacteriophage vector. Gene Y encodes a product called peptide Y. A region of gene Y contains the DNA sequence ATG-CGC-GAA-CTG-GTG-AAC-TAA. The researcher wishes to change a Val residue to an Ala residue in this region of peptide Y using site-directed mutagenesis. What should be the sequence of the mutant oligonucleotide primer in this region? You may use a codon table. mutant oligonucleotide primer sequence: GGC-GGC-GAA-CTG-GTG-AAC-TAA Incorrectarrow_forwardThe human hexokinase enzyme has the same function as the bacterial hexokinase enzyme but is somewhat different in its amino acid sequence. You have obtained a mutant bacterial strain in which the gene for hexokinase is missing. If you introduce into your mutant strain a DNA plasmid engineered to contain the DNA coding sequence of the human hexokinase gene, what must you also include? a)The human hexokinase promoter b)The bacterial hexokinase promoter c)Both the human and bacterial promoters d)You cannot engineer a bacteria to produce a human enzymearrow_forward
- The following sequence is from a region of the M13 bacteriophage genome. Identify and label the promoter elements that would be recognized by the bacterial RNA polymerase. Where would transcription begin? CAGGCGATGATCAAATCTCCGTTGTACTTTGTTTCGCGCGTTGGTATAATCGCTGGGGTCAAGATGAGTarrow_forwardBelow is the double stranded DNA sequence of part of a hypothetical yeast genome encoding a very small gene. Transcription starts at nucleotide immediately following the promoter. The termination sequence is TATCTC. How many amino acids will this protein have? 5' TCATGAGATA GCCATGCACTA AGGCATCTGA GTTTATATCT CA 3' 3' AGTACTCTAT CGGTACGTGAT TCCGTAGACT CAAATATAGA GT 5'arrow_forwardb) Shown below is a short gene of an unknown bacteria genome (Figure 2). (Note: Transcription starts at Transcription Start Site (TSS).) 5'TATTATAACGCATGACGAGCCATGCATTATCGGTATATGCACTGACCCGGAAAGGCTCCTTTTGGAGCCTTTTTT-3' 3'-ATAATATTGCGTACTGCTCGGTACGTAATAGCCATATACGTGACTGGGCCTTTTCCGAGGAAAACCTCGGAAAAA-5' Promoter (i) (ii) TSS (iii) Terminator Figure 2 Which DNA strand (the top or the bottom) is used by polymerase as a DNA template? List the mechanistic steps that can trigger the initiation of transcription by the Sigma Factor. What are the amino acids translated from the resulting mRNA? Indicate the amino (NH₂*) and carboxyl (COO) termini of the polypeptide chain.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license