The process of transcription, and explain how DNA, RNA, and RNA polymerase interact to produce a strand of RNA. Introduction: Transcription is a biological process in which a template DNA is used to synthesize a complementary RNA strand. Transcription is facilitated by an enzyme called RNA polymerase, and other transcriptional factors. The RNA polymerase plays a key role in RNA synthesis. It breaks the hydrogen bonds between the double-stranded DNA to make it single stranded which act as template DNA for the RNA synthesis.

Question

Want to see the full answer?

Answer 1

Question

Chapter 13.2, Problem 1CYL

Summary Introduction

To describe:

The process of transcription, and explain how DNA, RNA, and RNA polymerase interact to produce a strand of RNA.

Introduction:

Transcription is a biological process in which a template DNA is used to synthesize a complementary RNA strand. Transcription is facilitated by an enzyme called RNA polymerase, and other transcriptional factors. The RNA polymerase plays a key role in RNA synthesis. It breaks the hydrogen bonds between the double-stranded DNA to make it single stranded which act as template DNA for the RNA synthesis.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Students have asked these similar questions

Date: Class: Name: Transcription Questions Answer the following questions. 1. What bases are found in RNA? 2. What bases are found in DNA? 3. Which strand is the messenger RNA complementary to? 4. Which strand is the messenger RNA nearly identical to? 5. What proteins help to direct the RNA Polymerase to the right location? 6. The end of a new nucleotide is always added to the end of an existing strand. 7. Distinguish between the following two terms: chromosome and gene. 8. Scientists have long referred to the DNA between genes as "junk DNA". But as scientists study the genome, they discover new and unique reasons why this DNA is not really "junk". Using internet resources, research 2 functions for sections of DNA in between genes. Describe your findings below. C) 2015 Bethany Lau.

. Locate the -10 region hexanucleotide sequence in the following coding strand of DNA. Indicate the region of the RNA polymerase initiation site. AATTGGGATCCCTATAATGCGCCTACGTTGAGACGAGTGGACGC

A. In transcription, a region of DNA opens up. One strand, the template strand, serves as a template for synthesis of a complementary RNA transcript. The other strand, the coding strand, is identical to the RNA transcripf in sequence, except that it has uracil (U) bases in place of thymine (T) bases. Given the following piece of messenger RNA (MRNA): CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCC... Answer the following questions. 1. List the complementary non-coding DNA sequence. This refers to the template strand. (Please insert a space every after three letters for easy checking of your papers. Thank you.) 2. List the DNA strand sequence complementary to the template strand. This refers to the coding strand. (Please insert a space every after three letters for easy checking of your papers. Thank you.) 3. List the amino acid sequence of the protein coded for. (Please insert a space every after one amino acid for easy checking of your papers. Thank you.)