This model represents protein synthesis since the TRNA is delivering amino acids to form a polypeptide chain that will form a protein. This model represents protein synthesis since the tRNA is delivering lipids which will be used to bond proteins to form an enzyme. This model represents protein synthesis because DNA is being copied during transcription in the nucleus before leaving the nucleus. This model represents protein synthesis because mRNA is coiling to form a new protein molecule in the cytoplasm.

This model represents protein synthesis since the TRNA is delivering amino acids to form a polypeptide chain that will form a protein. This model represents protein synthesis since the tRNA is delivering lipids which will be used to bond proteins to form an enzyme. This model represents protein synthesis because DNA is being copied during transcription in the nucleus before leaving the nucleus. This model represents protein synthesis because mRNA is coiling to form a new protein molecule in the cytoplasm.

Name: AKS 5c1: Which explanation accurately describes the model below? *DNA
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: AKS 5c1: Which explanation accurately describes the model below? *DNAMRNA TranscriptionMature MRNANucleusTransport to cytoplasm forprotein synthesis (ranstationMANACell membraneThis model represents protein synthesis since the tRNA is delivering ami

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter15: From Dna To Protein

Section: Chapter Questions

Problem 10TYK: A part of an mRNA molecule with the sequence 5-UGC GCA-3 is being translated by a ribosome. The...

See similar textbooks

Similar questions

BONUS: In Bacteria, recognizes the Ribosomal Binding site on mRNA and catalyzes formation of peptide bonds during translation (answers must be in correct order) O aminoacyl tRNAses; aminoacyl TRNA synthetases ribosomal protein translation factors; ribosomal protein initiation factors O helicase; gyrase O 165 rRNA; 23S rRNA
Genetic expression involves transcription and translation. Match the structure or molecule to the step site where amino acid combines with tRNA intron sequences are removed and exons are combined together makes RNA more stable in the cytoplasm region of DNA with sequences that combine with RNA polymerase transcribed strand that will go on to translation connects amino acid to polypeptide chain and leaves tRNA site where tRNA with amino acid enters the ribosome recognized by the protein synthesis machinery enzyme that connects RNA nucleotides to DNA template part of tRNA with nucleotides complementary to mRNA 1. peptide bond 2. 3. antisense strand 4. anticodon loop 5. RNA polymerase 5' cap 6. A site 8. 7. splicing 9. promoter region acceptor stem 10. poly-A tail
Name: Clas: Date: Transcription 3" ATGACGGATCAGCCGCAAGOCGGAAfTGGCGACATAA UACUGCCUAGUCGGCGUU 3 5' WA WAW TACTGCCTAGTCGGCG TCGCCTTAACCGCTGTATT 3' 6 Label the diagram as you read the following passage. Transcription is the process cells use to copy information from DNA into messenger RNA copies. Part of the chromosome's tightly wound-up long strand of DNA is "loosened" to allow for RNA polymerase room to copy part of the DNA. Think of this as opening a page out of a giant book with thousands of pages to make a copy of just that one page. One side of the DNA strand is the template strand (or anti-sense strand) and is used by an enzyme called RNA Polymerase to create the messenger RNA. RNA Polymerase is directed by a bunch of proteins called transcription factors to the spot it needs to start copying. RNA Polymerase reads the template strand from the 3' end to the 5' end and creates a messenger RNA strand that is complementary to the template strand. In the diagram above, you can see that…
DNA: 5’-CTCTACTATAAACTCAATAGGTCC-3’ Draw a box around the sequence where RNA polymerase will bind to the DNA. What is this sequence called? Will transcription start at this sequence, to the left of this sequence (“upstream”) or, to the right of this sequence (“downstream”)? Draw a small arrow above the DNA strand where transcription will begin. Which DNA strand will RNA polymerase transcribe? Highlight this strand with your highlighter. (Hint: RNA pol is similar to DNA pol because it can only make new RNA in the 5’ to 3’ direction. Draw in an arrow to show the direction that RNA polymerase will move along the DNA strand.
Sources of Variability 1. If a point mutation occurred so that adenine was changed to thymine in the amino acid triplet code CTA, what would the resulting amino acid be? 3. What is the complementary DNA code for the following base sequence (from a section of DNA)? ATG C C C G G C CT TATTTTCTACA TGGT b. What is the complementary mRNA code? c. What is the tRNA code for this sequence? ACTT
codon: 1 2 3 4 5 6 7 sequence: TAC ATG GAC AAT GAT TAG GGG 1. What is the sequence of the peptide that would result following translation with a ribosome? Write your answer like this Met Ala Gly...... 2. What mutation(s) would change the peptide to Met Asp Asn Gly Leu Gly ? Use the codon numbers to help describe where the mutation is located . What mutation(s) would eliminate peptide translation? Use the codon numbers to help describe where the mutation is located
E channel Charged tRNA Anticodon for START Initiating factors Release factors m III III exit site for an uncharged stem of tRNA UAC located on tRNA's anticodon arm proteins that help mRNA bind to a small and large ribosomal subunit to start translation a tRNA that contains its appropriate amino acid attached to the acceptor arm bind to STOP codons and result in a hydrolysis reaction that creates a drop of water that halts translation
mRNA: 5’ – UGAUCAUGAUCUCGUAAGAUAUC – 3’ -Draw a box around the sequence where protein synthesis will begin. What is this sequence called? Does an amino acid get inserted at this site? If so, which one? -Draw in an arrow to show the direction that a ribosome will move along the mRNA strand. -From the starting point, mark off the codons, and identify the correct amino acid that will be inserted at that codon. -Draw a second box around the sequence where protein synthesis will stop. What is this sequence called? -Label the N-terminus and C-terminus of the polypeptide (amino acid) chain.
Iove aIung the HRNA from codon to codon, the appropriate amino acids are brought into place and linked together according to the sequence of codons. Thus, the code in the mRNA is translated into a special sequence of amino acids. The order of the amino acids in the protein, therefore, is specified by the MRNA, which in turn is transcribed from the DNA. Procedures and Observations: During transcription, the DNA double helix unwinds and "unzips. The two strands separate as the hydrogen bonds binding the nitrogen bases break. Then, nucleotides present in the cell line up along one strand of the DNA, the order of the nucleotides determined by the order of the nucleotides in the DNA. As the mRNA forms, uracil (U) nucleotides match with adenine (A) nucleotides; cytosine (C) nucleotides match with guanine (G) nucleotides. Note: RNA contains uracil (U) nucleotides where thymine (T) nucleotides would occur in DNA. The nucleotides in the newly formed mRNA are complementary to the nucleotides of…
AKS 5c1: Which of the following models BEST represents protein synthesis? * O MRNA (UAC AAA) - DNA (ATG TTT) Amino Acid Sequence (Lysine-Alanine) - Amino Acid Sequence (Methionine- DNA (TAC AAA) RNA (AUG UUU) Phenylalanine) RNA (AUG UUU) DNA (TAC Amino Acid Sequence (Methionine-Phenylalanine) AAA) DNA (AUG UUU) RNA (TAC AAA) Phenylalanine) - Amino Acid Sequence (Methionine- AKS 5c1: Using codon wheel below, which of the models correctly represents the usage of the base pairing rule, the correct sequence of events, and creation of proteins at the ribosomes? *
C. Convert the DNA template to mRNA. Then, convert the mRNA to tRNA. Based from the resulting sequence in the anticodons of tRNA, determine the appropriate Amino acid sequence that will be synthesized. Refer to the genetic code. 1. DNA Template: TAC - GGC - TAC - CAT - ATG - GAG mrNA: tRNA: Amino acid sequence: 2. DNA Template: TTA - CAT - CAT - ATC - GAT - GAC mrNA: tRNA: Amino acid sequence: 3. DNA Template: CTA - GCG - ATA - AAA - TTT - ATT mrNA: tRNA: Amino acid sequence:
. What is the minumum number of tRNA molecules that a cell must contain in order to translate all 61 sense codons?