Open reading frames... correspond to introns, which are not read by the ribosome during translation correspond to contiguous fragments of DNA sequence that do not contain a stop codon when read in a particular frame correspond to contiguous fragments of DNA sequence that do not contain a stop codon when read in any of six frames are often rich in acetylated histones which allow transcription occur when fragments of DNA sequence are highly similar between two species are recognized by ribosomes to initiate translation

E21.

. What is the minumum number of tRNA molecules that a cell must contain in order to translate all 61 sense codons?

mRNA sequence of A gene Find start codon and stop codon 5’ AAACUGUGACUGAACCUCAAACCCCAAACCAGCCCGAGGAGAACCACAUUCUCCCAGGGA CCCAGGGCGGGCCGUGACCCCUGCGGCGGAGAAGCCUUGGAUAUUUCCACUUCAGAAGCCUACUGGGGAAGGCUGAGGGGUCCCAGCUCCCCACGCUGGCUGCUGUGCAGAUGCUGGACGACAGAGCCAGGAGGGAGGCCGCCAAGAAGGAGAAGGUAGAGCAGAUCCUGGCAGAGUUCCAGCUGCAGGAGGAGGACCUGAAGAAGGUGAUGAGACGGAUGCAGAAGGAGAUGGACCGCGGCCUGAGGUAGAAGCCGCUGGGGCUUGGGGCU-3’

What is the importance of the anticodon on the tRNA?

The subunits of the translation initiation complex in PROKARYOTES.* 1 point O 30S and 50S O 40S and 60S O 20S and 60S O 10S and 70S Normal pH of the human blood? * 1 point O 7.30 to 7.40 O 7.35 to 7.45 O 7.40 to 7.50 O 7.45 to 7.55 A structural motif that contains 2 cysteine and 2 histidine amino acids. * I point Helix-turn-helix Motif

Can you explain it?

Sources of Variability 1. If a point mutation occurred so that adenine was changed to thymine in the amino acid triplet code CTA, what would the resulting amino acid be? 3. What is the complementary DNA code for the following base sequence (from a section of DNA)? ATG C C C G G C CT TATTTTCTACA TGGT b. What is the complementary mRNA code? c. What is the tRNA code for this sequence? ACTT

help

Template strand: 5' AATCATAACTCATTG 3' A. Write the CODING strand of this sequence, including the 5' and 3' end designations. B. Write the amino acid sequence coded by this mRNA. The start codon is the first codon in the sequence that codes for Met. First position (5'-end) U < G บบบ UUC phe UUA UUG CUU Couleu CUC Coc CUA CUG AUU AUG AUC ile GUU GUC GUA GUG Second position C UCU UCC UCA UCG val CCU co CCC CCA 000 CCG ACU ACC ACC AUA ACA thr AUA ACA AUG met ACG GCU GCC ser GCA GCG pro ala UAU ORD tyr UAC UAA Stop UAG Stop CAU CAC CAA CAG - AAU AAC www AAA 10 asn AAG 7 his GAU GAC GAA GAG gin }| lys asp glu UGU UGC cys UGA Stop UGG trp CGU C00 CGC CGA 000 CGG AGU AGC ACA AGA AGG GGU GGC GGA GGG Initiation Termination arg ser arg gly DUAL SUAU DUAU DUAG Third position (3-end)