Open reading frames... correspond to introns, which are not read by the ribosome during translation correspond to contiguous fragments of DNA sequence that do not contain a stop codon when read in a particular frame correspond to contiguous fragments of DNA sequence that do not contain a stop codon when read in any of six frames are often rich in acetylated histones which allow transcription occur when fragments of DNA sequence are highly similar between two species are recognized by ribosomes to initiate translation

Q: The sequence below represents the template strand of DNA of the first two exons (out of 5) of a…

A: DNA is the hereditary material present in most of the eukaryotic organisms.The full form of DNA is…

Q: The drug, erythropoietin (EPO) is an artificial version of a protein that is naturally produced by…

A: DNA is the double-stranded molecule that is the genetic material in most animals except for some…

Q: describe the process of translation/protein synthesis at the ribosome based on these figures

A: Answer: TRANSLATION = It is the process in central dogma where mRNA is translated in to proteins in…

Q: What anticodon sequences of tRNAs are coded for by the mRNA codons below? (Enter each sequence in 5'…

A: An mRNA molecule's complementary sequence forms a binding with the three nucleotides that make up…

Q: DNA sense or template DNA sense or template mRNA tRNA protein 5', 3' amino or carboxyl 5' T A U A R…

A: DNA -> Transcription -> mRNA -> Translation -> ProteinTranscription is the synthesis of…

Q: 2. Given a DNA template molecule of 5'- ATGGCTCCTACCTACTAGTTAACATATGG-3', generate the mRNA sequence…

A: We are given a sequence of DNA in 5'-3' direction.  We have to generate the mRNA sequence and then a…

Q: What are the functional consequences of this deletion for lilP mRNA transcription and translation?…

A: Introduction :- A deletion mutation is a type of genetic mutation that involves the loss of one or…

Q: An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP…

A: Answer : glycine, proline, alanine, arginine,  The possible codons can be  CCG CGC GCC GGC GCG CGG

Q: Remember when looking up a codon make sure it is in its mRNA form.   Below is a sample of a…

A: The spontaneous changes in the DNA that changes the original base sequence is called mutation. For…

Q: Draw a labelled diagram depicting the flow of genetic information from DNA to mRNA of a eukaryotic…

A: A fundamental principle that describes how genetic information moves throughout a biological system…

Q: 4. Match the terms on the left with those on the right: AUG dihydrouridine Esite

A: Above given in the match the following are the terms involved in the translation process studied in…

Q: a. In your claim words, depict the contrast between ρ-dependent and ρ-independent end of translation…

A: ρ-dependent is basically a translation termination mechanism occuring in prokaryotic cells. Here ρ…

Q: What is not true about the difference between translation in prokaryotes and eukaryotes? O in…

A: mRNA (messenger ribonucleic acid) is a type of RNA that carries genetic instructions from DNA to the…

Q: The antibiotic erythromycin disrupts protein synthesis by binding to the 50 S subunit and preventing…

A: tRNA is the transfer RNA . It is the smallest of three major species of RNA molecule. They transfer…

Q: Given an artificial mRNA consisting of a repeated dinucleotide (5'... GUGUGUGUGUGU... 3), match the…

A: A codon is a group of three DNA or RNA nucleotides that codes for a particular amino acid or protein…

Q: Can you explain it?

A: If the mRNA sequence is given, we can find out the amino acid sequence by looking at the genetic…

Q: Describe translation. What is the function of the aminoacyl-tRNA synthase?

A: Protein synthesis: It is a process that involve peptide bond formation between the amino acids by…

Q: sequence belo - Indicate the start site for translation by underlining the start codon. - Translate…

A: mRNA sequence 5' GUAGUCAUGCCCGACGCAUUUACGAUUCAGUGACUG 3'. The codons are triplet in nature and the…

Q: Give typing answer with explanation and conclusion Which of the following statements regarding the…

A: Understanding the structure and function of tRNA is crucial for comprehending the intricate process…

Q: Draw a schematic of translation. Include the following: • 5'and 3'of MRNA nucleic acid • N and C of…

A: The process in which information on mRNA is translated in protein is called as translation.

Q: IIT TTC amino acid sanon TTA TTG CTT СТС СТА СТG phenylalanine ATT АТС АТА leucine GTT GTC GTA GTG…

A: Sense strand of DNA- 5'-CATCCAAATTGTTGCCCG-3' Antisense strand of DNA-  3'- GTAGGTTTAACAACGGGC-5'…

Q: following RNA strand. CGCUACAUCUUU b. If a gene mutation results in a frame shift, meaning the RNA…

A: A) The output from the given nucleotide sequence is RYIF which is Arginine>Tyrosine>…

Q: . If tRNA is the adaptor for translation, what is theribosome?

A: Translation refers to the process of protein synthesis in the cells.  The process of translation…

Q: Row A. B. C D. Protein Synthesis in an Animal elect the row below that correctly identifies the name…

A: Ribosomes create proteins as part of the biological process known as protein synthesis, which is…

Q: Is this diagram of tRNA technically incorrect? Shouldn't it be 3' on the left and 5' on the right…

A: The tRNA or the transfer acyl Ribonucleic Acid serves as an adapter molecule during the process of…

Q: Which term describes each of these steps or substeps in the translation process? The ribosome shifts…

A:

Q: Classify the following functions or structures as being attributed to proteins, RNA, or RNA-protein…

A: A. Proteins -  Poly A polymerase Release factors (RF1 and RF2) Formation (catalysis) of peptide…

Q: Which of the following describes the most likely effect that a single base substitution in the…

A: Point mutation It is a type of genetic mutation in which a single nucleotide base gets altered,…

Q: Need help Below is a strand of mRNA with three codons listed on the strand. Imagine the mRNA strand…

A: Translation is a process of reading of mRNA to form proteins. It requires several components ljke…

Q: Discuss why you think the ribosomes need to contain so many proteins and rRNA molecules. Does it…

A: Ribosomes are present in both plant and animal cells. they are present in both prokaryotic and…

Q: Refer to the codon diagram on. Which of the following is a codon that will terminate translation?*

A: A termination codon or a stop codon is a group of three amino acids that is present in the mRNA that…

Q: DNA RNA Triplet codon Transcription Translation TATA box Start codon RNA processing 5' cap poly A…

A: Introduction  DNA is a double-stranded molecule with a lengthy sequence of nucleotides. A…

Q: Some tRNAs can recognize more than one codon because there is a relaxation of the complementation…

A: Translation of mRNA into protein requires a specialized adapter molecule called tRNA and ribosomes.…

Q: 4a. Was this micrograph taken of a sample prepared from human cells or prokaryotic cells? How do you…

A: Since you have posted a question with multiple subparts, we will solve the first three subparts for…

Q: 5' 2. Explain what indicates the beginning of translation, and what tRNA's role is in translation.…

A: TRANSLATION: The method used by a cell to produce proteins utilizing genetic information conveyed by…

Q: None

A: Step 1: Understanding the Anticodon and Codon RelationshipAnticodon: The anticodon is a sequence of…

Q: 25.  A portion of an mRNA attached to a ribosome reads:   5′ GACAUGAACAGC 3′ If a tRNA with a…

A: The translation is a process of Protein synthesis where a copy of mRNA is used as a template strand.…

Q: Label if each of the fonowing Sequences are present in DNA, pre-RNA andlor MRNA Of eukanyotes :…

A: All the information is present in the DNA that will be required for the synthesis of proteins. In…

Q: hange the peptide to Met Asp Asn Gly Leu Gly ?    Use the codon numbers to help describe where the…

A: Since you have posted a question with multi- sub parts , we will solve first three sub-parts for…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.