Biology
12th Edition
ISBN: 9780134813448
Author: Audesirk, Teresa, Gerald, Byers, Bruce E.
Publisher: Pearson,
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 13, Problem 2RQ
Name the three types of RNA that are essential to protein synthesis. What is the function of each?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
What are the two main steps to protein synthesis and where do they take place?
What are the different types of RNA used and what are their roles?
How important is nucleotide order to the process?
a) Identify three types of RNA and provide a description of each and the role they
play in protein synthesis.
(6 marks)
b) Use the DNA sequence below to answer the following questions.
3' - TACGAACGAGTGCCCCAAAATT -5'
What is the complementary DNA strand?
(1 mark)
What is the nucleotide sequence of the mRNA strand transcribed from the initial
DNA strand?
(1 mark)
Provide an alternative mRNA sequence with four changes that would translate to the
same amino acid sequence. (2 marks)
Paragraph
I
A
+ v
...
Lato (Recom... v
19px ... v
Add a File
Record Audio
Record Video
MacBook Pro
G Search or type URL
#3
2$
&
(
3
4
7
8
9
山訓
< CO
which statement about genetic code is not true?
A) mRNA is read 3 bases at a time, which are called codons. B) There is one initiator codon that codes for an amino acid. C) Each amino acid is coded for by only one codon. D) There are 3 termination codons that do not code for amino acids. E) Each codon is specific for only one amino acid.
An anion has an equilibrium potential of -40 mV. What direction are the chemical and electrical forces acting on the anion at the resting membrane potential (-70 mV)?
A) Both the chemical and electrical forces are directed out of the cell. B) The chemical force is directed out of the cell and the electrical force is directed into the cell. C) The chemical force is directed into the cell and the electrical force is directed out of the cell. D) There is insufficient information to answer this question. E) Both the chemical and electrical forces are directed into the cell.
Chapter 13 Solutions
Biology
Ch. 13.1 - describe three types of RNA that play roles in...Ch. 13.1 - Prob. 2CYLCh. 13.1 - Prob. 3CYLCh. 13.2 - Prob. 1TCCh. 13.2 - Prob. 1CYLCh. 13.2 - Prob. 2CYLCh. 13.2 - describe an example of post-transcription...Ch. 13.3 - Prob. 1TCCh. 13.3 - Prob. 1CSCCh. 13.3 - Prob. 1CYL
Ch. 13.3 - Prob. 2CYLCh. 13.3 - Prob. 3CYLCh. 13.3 - Prob. 4CYLCh. 13.4 - Prob. 1CSCCh. 13.4 - describe three different types of mutations?Ch. 13.4 - Prob. 2CYLCh. 13.5 - Prob. 1HYEWCh. 13.5 - Envision yourself as a physician. A mother,...Ch. 13.5 - Prob. 2TCCh. 13.5 - Prob. 1CYLCh. 13.5 - Prob. 2CYLCh. 13.5 - Prob. 3CYLCh. 13.5 - Prob. 4CYLCh. 13.5 - Prob. 1CTCh. 13 - Prob. 1MCCh. 13 - Which of the following is not true of RNA? a. It...Ch. 13 - Prob. 3MCCh. 13 - Prob. 4MCCh. 13 - Prob. 5MCCh. 13 - Synthesis of RNA from the instructions in DNA is...Ch. 13 - Prob. 2FIBCh. 13 - Prob. 3FIBCh. 13 - Prob. 4FIBCh. 13 - Prob. 5FIBCh. 13 - If a nucleotide is replaced by a different...Ch. 13 - Prob. 1RQCh. 13 - Name the three types of RNA that are essential to...Ch. 13 - Prob. 3RQCh. 13 - Prob. 4RQCh. 13 - Prob. 5RQCh. 13 - Prob. 6RQCh. 13 - Prob. 7RQCh. 13 - Define mutation. Describe four different effects...Ch. 13 - Prob. 1ACCh. 13 - Prob. 2AC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- A segment of DNA has the followimg sequence of bases.. 5'-ATGCAATGATATTGAAGCTTA-3' a) What sequence of bases would appear in mRNA transcribed from this segment? b) Assume the first base in this mRNA is the beginning of a codon. What order of amino acid would be translated into a polypeptide synthesized along this segment? c) Give anticodons for each tRNA associated with the translation in part (b)arrow_forwardMatch the function in translation to each type of RNA (one RNA has two listed functions). 1) Carry an amino acid that is encoded by a codon. 2) Serve as the link between DNA and proteins. 3) Create the backbone of the ribosome 4) Has triplet-nucleotide codons that encode the primary structure of proteins. Here are the choices for the questions: a) tRNA b) rRNA c) mRNAarrow_forwardWhich of the following best describes a stop codon? A) They are codons that indicate termination of protein synthesis. B) They are codons that are extra in the genetic code and are not used. C) They are codons that indicate when to create new peptide bonds. D) They are codons that signal when the RNA strand is done being read. E) They are codons that indicate when to begin folding the polypeptide.arrow_forward
- Consider a template strand of DNA with the following sequence: 3 '–CAA TGT ATT TTT GCT–5 '. (a) What is the informational strand of DNA that corresponds to this template? (b) What mRNA is prepared from this template? (c) What polypeptide is prepared from the mRNA?arrow_forwardWhich of the following is NOT true regarding the genetic code and translation? a) An mRNA is typically translated in only 1 reading frame. b) There are 64 different codons. c) Multiple amino acids may be coded for by a single codon. d) mRNA sequence is the reverse complement of the template strand of DNA.arrow_forwardFor translation of eukaryotic mRNA sequences: a) The stop codon stops translation by blocking the ribosome. b) The tRNA is the same thing as the amino acid. c) There are two binding pockets within the ribosome where different tRNAs will bind to the mRNA. d) The first codon that is recognized by the ribosome is UAG e) The ribosome can bind to the mRNA in any location.arrow_forward
- If DNA codes for mRNA and mRNA codes for protein, then how can the same DNA sequence generate different proteins? What are the 3 tRNA sites on the small ribosomal subunit (just abbreviations)? What is the order of tRNA entrance and exit through the ribosome?arrow_forwardA DNA strand consists of any sequence of four kinds of nucleotides. Suppose there were only 14 different amino acids instead of 20. Which of the following statements would be correct descriptions of the minimal number of nucleotides necessary to create a genetic code? a) 1 b)2, provided that chain termination does not require a special codon c) 3, provided that chain termination does require a special codon d)2, no matter how chain termination is accomplished e) Both b and carrow_forwardWhat is the significance (or function) of tRNA in protein synthesis? In other words, explain why tRNA is so important. How many different tRNA’s are there?arrow_forward
- 3)Which of the following statements are true? Choose all that apply a)There are multiple codons possible for nearly all amino acids b)Each stop codon also codes for an amino acid c)Each tRNA will base pair with only one codon d)The start codon also codes for an amino acid e)Each codon in mRNA codes for exactly one amino acid f)Each codon in tRNA codes for exactly one amino acid g)Each anticodon in tRNA pairs with exactly one codon h)Each tRNA carries exactly one type of amino acidarrow_forwardHow is each tRNA charged with the correct amino acid? What are the consequences of a tRNA carrying an incorrect amino acid?arrow_forwardWhat is the name of the process by which amino acids arelinked together in the correct order based on an RNA sequence?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license