Genetics: Analysis and Principles
6th Edition
ISBN: 9781259616020
Author: Robert J. Brooker Professor Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 13, Problem 2EQ
Polypeptides can be translated in vitro. Would a bacterial mRNA be translated in vitro by eukaryotic ribosomes? Would a eukaryotic mRNA be translated in vitro by bacterial ribosomes? Why or why not?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Microbiologists describe the processes of transcription and translation as “coupled” in bacteria. This term indicates that bacterial mRNA can be undergoing transcription at the same moment it is also undergoing translation.
How is coupling possible in bacteria?
Is coupling of transcription and translation possible in single-celled eukaryotes, such as yeast? Why or why not?
MRNAs and eukaryotic cells receive different modifications than those in prokaryotic cells, because eukaryotic mRNAs must be able to accomplish different things. Which of the following describes events that are necessary for an mRNA to be expressed in a eukaryotic cell, but are not necessary for mRNAs in a prokaryotic cell? select all that apply
A) introns must be removed from the eukaryotic mRNA
B) The mRNA must leave from the nucleus
C) transcription factors must bind to the mRNA in a eukaryotic cell after it is transcribed
D) A ribsome must bind to the mRNA
.
An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP and GTP. When this RNA is used in an in vitro translation system, all of the following amino acids could be incorporated into a newly made polypeptide, except:
glycine (Gly)
histidine (His)
proline (pro)
alanine (Ala)
arginine (Arg)
Chapter 13 Solutions
Genetics: Analysis and Principles
Ch. 13.1 - Prob. 1COMQCh. 13.1 - 2. The reason why Beadle and Tatum observed four...Ch. 13.2 - What is the genetic code? a. The relationship...Ch. 13.2 - Prob. 2COMQCh. 13.2 - The fourth codon in an mRNA sequence is GGG, which...Ch. 13.2 - Prob. 4COMQCh. 13.3 - Prob. 2COMQCh. 13.4 - Prob. 1COMQCh. 13.4 - 2. The anticodon of a tRNA is located in the
a....Ch. 13.4 - An enzyme known as _______attaches an amino acid...
Ch. 13.5 - Each ribosomal subunit is composed of a. multiple...Ch. 13.5 - Prob. 2COMQCh. 13.6 - 1. During the initiation stage of translation in...Ch. 13.6 - The Kozak rules determine a. the choice of the...Ch. 13.6 - During the peptidyl transfer reaction, the...Ch. 13.6 - A release factor is referred to as a molecular...Ch. 13 - Prob. 1CONQCh. 13 - What does it mean when we say that the genetic...Ch. 13 - According to the adaptor hypothesis, is each of...Ch. 13 - Prob. 4CONQCh. 13 - Prob. 5CONQCh. 13 - 6. The wobble rules for tRNA-mRNA pairing are...Ch. 13 - Prob. 7CONQCh. 13 - Prob. 8CONQCh. 13 - Prob. 9CONQCh. 13 - If a tRNA has an anticodon sequence 3CCI5, what...Ch. 13 - Describe the anticodon of a single tRNA that could...Ch. 13 - Prob. 12CONQCh. 13 - Prob. 13CONQCh. 13 - 14. What is the role of aminoacyl-tRNA synthetase?...Ch. 13 - Prob. 15CONQCh. 13 - 16. Discuss the significance of modified bases...Ch. 13 - How and when does formylmethionine become attached...Ch. 13 - Prob. 18CONQCh. 13 - Prob. 19CONQCh. 13 - Prob. 20CONQCh. 13 - The term subunit can be used in a variety of ways....Ch. 13 - 22. Do the following events during bacterial...Ch. 13 - 23. What are the three stages of translation?...Ch. 13 - Prob. 24CONQCh. 13 - 25. For each of the following initiation factors,...Ch. 13 - Prob. 26CONQCh. 13 - 27. For each of the following sequences, rank them...Ch. 13 - Prob. 28CONQCh. 13 - Prob. 29CONQCh. 13 - Prob. 30CONQCh. 13 - Prob. 31CONQCh. 13 - In which of the ribosomal sites, the A site, P...Ch. 13 - Prob. 33CONQCh. 13 - Prob. 34CONQCh. 13 - Prob. 35CONQCh. 13 - Prob. 36CONQCh. 13 - Prob. 37CONQCh. 13 - 1. In the experiment of Figure 13.7, what would be...Ch. 13 - 2. Polypeptides can be translated in vitro. Would...Ch. 13 - Discuss how the elucidation of the structure of...Ch. 13 - Describe the structure of a polysome, which is...Ch. 13 - Prob. 5EQCh. 13 - 6. The technique of Western blotting is described...Ch. 13 - The protein known as tyrosinase is needed to make...Ch. 13 - Prob. 8EQCh. 13 - Discuss why you think the ribosomes need to...Ch. 13 - 2. Discuss and make a list of the similarities...Ch. 13 - 3. Which events during translation involve...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Which of the following interactions in E. coli ensures that the start codon of an mRNA is accurately positioned in a ribosome at the initiation of translation? O binding between the mRNA Shine-Dalgarno sequence and ribosomal proteins base-pairing between the mRNA Shine-Dalgarno sequence and rRNA of the small ribosomal subunit O binding between ribosomal proteins and the initiation factor that base-pairs with the start codon O base-pairing between the mRNA Shine-Dalgarno sequence and rRNA of the large ribosomal subunitarrow_forwardImagine you are going to label a gene associated with apoptosis in Symbiodiniaceae with a Yellow Fluorescent Protein (YFP). To generate the YFP, you know the pre-MRNA looks as follows: Unspliced YFP premature mRNA Сap 5' UTR Exon 1 Intron Exon 2 Intron Exon 3 3' UTR Poly-A tail If Exon 2 is also required for mRNA stability, what can be predicted from the possible spliced alternative isoforms formed? One of the isoforms will not have a poly-A tail O The alternative splicing of YFP pre-MRNA prevents 5'-capping The MRNA isoform without Exon 2 will be degraded faster than the other isoform Exon 2 will be added to isoform B later to correct the mistake in splicing The protein translated from one of the mRNA isoforms will possess an additional functional domainarrow_forwardWhich of the followings indicate the order of procaryotic mRNA degreadation? cleavage of the triphosphate 5′ terminus to yield a monophosphate- 3′ to 5′exonuclease digestion- The endonucleolytic cleavages occur in a 5′ to 3′ direction on the mRNA following the passage of the last ribosme cleavage of the triphosphate 5′ terminus to yield a monophosphate- The endonucleolytic cleavages occur in a 5′ to 3′ direction on the mRNA following the passage of the last ribosme- 3′ to 5′exonuclease digestion The endonucleolytic cleavages occur in a 5′ to 3′ direction on the mRNA following the passage of the last ribosme- cleavage of the triphosphate 5′ terminus to yield a monophosphate- 3′ to 5′exonuclease digestionarrow_forward
- Introns are often very large and the cell has devoted mechanisms of eliminating them once they are excised from the pre-mRNA. Following intron excision, what specific ribonucleolytic enzymes or complexes contribute to eliminating the intron RNA immediately after it is excised from the pre-mRNA? Briefly describe the role of each step/enzyme and how it affects its RNA substratearrow_forwardWhen a eukaryotic gene is cut out of genomic DNA, geneticists have discovered that enabling the strands to hydrogen bond allows them to hybridize one of the gene's strands to the mRNA for that gene. How can you tell whether this gene undergoes alternative splicing by comparing the mRNAs that result?arrow_forwardExplain why prokaryotic ribosomes can translate a circular mRNA molecule, whereas eukaryotic ribosomes normally cannot, even in the presence of the required cofactors.arrow_forward
- The following is the only intron sequence of a gene that will be excised during the maturation of the mRNA. But it is not spliced in some tissues, where alternative splicing pattern is seen. Will the amino acid of its protein product following this sequence change? Explain with an example. ATGATAGCCAGACTCGCAarrow_forwardThe following is the only intron sequence of a gene that will be excised during the maturation of the mRNA. But it is not spliced in some tissues, where alternative splicing pattern is seen. Will the amino acid of its protein product following this sequence change? Explain with an example. ATGATAGCACCAGACTCGCAarrow_forwardThe genetic code was solved partly by the use of in vitro systems to translate synthetic RNAs into peptides. In these systems, ribosomes, amino acids, and buffers that support translation are added and there is no control of where translation begins. AAA = Lys; AUA = Ile; AAU = Asn; UAA = stop. What peptides would NOT be produced in an in vitro system if the following oligonucleotide were added: AAAAAAAAAUAAAAAAAA Select one: a) Lys-Lys-Lys-Lys-Lys-Lys-Lys-Lys b) Lys-Lys-Ile-Lys-Lys c) Lys-Lys-Asn-Lys-Lysarrow_forward
- Explain the function of spliceosomes in eukaryotic cells. The following sequence represents pre-mRNA derived from a gene coding for alpha keratin in birds. Label the sequence to show potential exon(s), intron(s) and spliceosome cut site(s). That is, put the intron(s) sequences in parentheses and use black slash symbols (/) to indicate the spliceosome cut site(s). What is the sequence of the mature MRNA after splicing? [ 5' AUGGGUUUAGGACCCCCGAUAAA 3'arrow_forwardIn bacterial genes, as soon as any partial mRNA transcript is produced by the RNA polymerase system, the ribosome assembles on it and starts translating. Draw a diagram of this process, identifying 5′ and 3′ ends of mRNA, the COOH and NH2 ends of the protein, the RNA polymerase, and at least one ribosome. Why couldn’t this system work in eukaryotes?arrow_forwardA synthetic mRNA added to a cell-free protein-synthesizing system produces a peptide with the following amino acid sequence: Met-ProIle-Ser-Ala. What would be the effect on translation if the following component were omitted from the cell-free protein-synthesizing system? What, if any, type of protein would be produced? Explain your reasoning. Q. ATParrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license