Genetics: Analysis and Principles
6th Edition
ISBN: 9781259616020
Author: Robert J. Brooker Professor Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Question
Chapter 13, Problem 29CONQ
Summary Introduction
To review:
Sequence of amino acid of the polypeptide encoded by mRNA (messenger ribonucleic acid) 5`-AUG UAC CCG GCG UAA-3`.
Introduction:
Amino acids are chemically organic molecules that consist of amino group and carboxyl group. Out of four side chain, three are constant and only one side chain differs in all the amino acids that are represented by R. On the basis of side chain, there are four types of amino acids: polar uncharged amino acid, acidic amino acid, basic amino acid, and non-polar amino acid.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
An mRNA has the following sequence:
5′–AUG UAC UAU GGG GCG UAA–3′
Describe the amino acid sequence of the polypeptide that would be encoded by this mRNA. Be specific about the amino-terminus and carboxyl-terminus.
An mRNA has the following sequence:5′–AUG UAC UAU GGG GCG UAA–3′.Describe the amino acid sequence of the polypeptide that would be encoded by this mRNA. Be specific about the amino-terminal and carboxyl-terminal ends.
Given the following mRNA sequence, write the peptide sequence that will result from protein translation. Please indicate the correct directionality.
Chapter 13 Solutions
Genetics: Analysis and Principles
Ch. 13.1 - Prob. 1COMQCh. 13.1 - 2. The reason why Beadle and Tatum observed four...Ch. 13.2 - What is the genetic code? a. The relationship...Ch. 13.2 - Prob. 2COMQCh. 13.2 - The fourth codon in an mRNA sequence is GGG, which...Ch. 13.2 - Prob. 4COMQCh. 13.3 - Prob. 2COMQCh. 13.4 - Prob. 1COMQCh. 13.4 - 2. The anticodon of a tRNA is located in the
a....Ch. 13.4 - An enzyme known as _______attaches an amino acid...
Ch. 13.5 - Each ribosomal subunit is composed of a. multiple...Ch. 13.5 - Prob. 2COMQCh. 13.6 - 1. During the initiation stage of translation in...Ch. 13.6 - The Kozak rules determine a. the choice of the...Ch. 13.6 - During the peptidyl transfer reaction, the...Ch. 13.6 - A release factor is referred to as a molecular...Ch. 13 - Prob. 1CONQCh. 13 - What does it mean when we say that the genetic...Ch. 13 - According to the adaptor hypothesis, is each of...Ch. 13 - Prob. 4CONQCh. 13 - Prob. 5CONQCh. 13 - 6. The wobble rules for tRNA-mRNA pairing are...Ch. 13 - Prob. 7CONQCh. 13 - Prob. 8CONQCh. 13 - Prob. 9CONQCh. 13 - If a tRNA has an anticodon sequence 3CCI5, what...Ch. 13 - Describe the anticodon of a single tRNA that could...Ch. 13 - Prob. 12CONQCh. 13 - Prob. 13CONQCh. 13 - 14. What is the role of aminoacyl-tRNA synthetase?...Ch. 13 - Prob. 15CONQCh. 13 - 16. Discuss the significance of modified bases...Ch. 13 - How and when does formylmethionine become attached...Ch. 13 - Prob. 18CONQCh. 13 - Prob. 19CONQCh. 13 - Prob. 20CONQCh. 13 - The term subunit can be used in a variety of ways....Ch. 13 - 22. Do the following events during bacterial...Ch. 13 - 23. What are the three stages of translation?...Ch. 13 - Prob. 24CONQCh. 13 - 25. For each of the following initiation factors,...Ch. 13 - Prob. 26CONQCh. 13 - 27. For each of the following sequences, rank them...Ch. 13 - Prob. 28CONQCh. 13 - Prob. 29CONQCh. 13 - Prob. 30CONQCh. 13 - Prob. 31CONQCh. 13 - In which of the ribosomal sites, the A site, P...Ch. 13 - Prob. 33CONQCh. 13 - Prob. 34CONQCh. 13 - Prob. 35CONQCh. 13 - Prob. 36CONQCh. 13 - Prob. 37CONQCh. 13 - 1. In the experiment of Figure 13.7, what would be...Ch. 13 - 2. Polypeptides can be translated in vitro. Would...Ch. 13 - Discuss how the elucidation of the structure of...Ch. 13 - Describe the structure of a polysome, which is...Ch. 13 - Prob. 5EQCh. 13 - 6. The technique of Western blotting is described...Ch. 13 - The protein known as tyrosinase is needed to make...Ch. 13 - Prob. 8EQCh. 13 - Discuss why you think the ribosomes need to...Ch. 13 - 2. Discuss and make a list of the similarities...Ch. 13 - 3. Which events during translation involve...
Knowledge Booster
Similar questions
- Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?arrow_forwardGiven the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:arrow_forwardA certain mRNA strand has the following nucleotide sequence: 5AUGACGUAUAACUUU3 What is the anticodon for each codon? What is the amino acid sequence of the polypeptide? (Use Figure 13-5 to help answer this question.) Figure 13-5 The genetic code The genetic code specifies all possible combinations of the three bases that compose codons in mRNA. Of the 64 possible codons, 61 specify amino acids (see Figure 3-17 for an explanation of abbreviations). The codon AUG specifies the amino acid methionine and also signals the ribosome to initiate translation (start). Three codonsUAA, UGA, and UAGdo not specify amino acids; they terminate polypeptide synthesis (stop).arrow_forward
- Refer to the information on the genetic code. Use this information to determine how many amino acids are coded for by the mRNA sequence AUGCGCAGUCGGUAG. The genetic code Second letter of codon UAU UAC JUU Phenylalanine uCU UUC Phe) UUA Leucine (Leu) UUG Tyrosine (Tyr) GCysteine (Cys) UGC 1oStop codon |UGG Tryptophan (Trp) CGU CGC UcC Serine (Ser) UCA ucc CCU cC Proline (Pro) Stop codon UAG Stop codon CAU Histidine His) CU CUC CUA CUG Arginine (Arg) Leucine (Leu) cca CAA CCA CGA Glutamine (Gin) CAG AUU AUC AUA ACU Isoleucine (le) AAU AAC AGU AGC Asparagine (Asn) Serine (Ser) ACC Threonine (Thr) ACA Methicnine ACC start codon GCU Lysine (Lys) AGA Arginine (Arg) ARC AGS GAU Aspartic acid (Asp)G0 GAC GUU GUC Valine (Val) GCC Alanine (Ab) GG Glycine (Gly GUA GUG GCA GCG GA Glutamic acid (Glu) GA GGG GAG 4 15 First letter of codon Third letter of codonarrow_forwardA segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following segment of DNA: GGCTAGCTGCTTCCTTGGGGA CCGATCGACGAAGGAACCCCT Note out the mRNA sequence generated by the template strant to produce that polypeptide chain Label each stran with its correct polarity (5' and 3' ends on each strand)arrow_forwardAssume the following portion of an mRNA. Find a start signal, and write the amino acid sequence that is coded for. 5'-GCCAUGUUUCCGAGUUAUCCCAAAGAUAAAAAAGAG 3'arrow_forward
- Indicate the amino acid sequence of the protein encoded by the following mRNA molecule. Use the genetic code table and assume that the very first “AUG” the ribosome encounters will serve as the start codon and specify methionine. 5’-AAUUCAUGCCCAAAUUUGGGGCACGAAGCUUCUUAGGCUAGUCCUAAAAAA-3’arrow_forwardGiven the genetic code below, enter the correct amino acid sequence for the following RNA sequence: AUG GAG UCC UUG CUG UGA (enter the amino acids as the 3 letter abbreviation on the table separated by dashes with no spaces e.g. Met-Thr-Lys-Glu-Ser) Alanine (Ala) AGUC Tyrosine (Tyr) Valine (Val) GU Cysteine (Cys) START HERE G Arginine (Arg) G Tryptophan (Trp) A C CUGA Serine (Ser) Leucine (Leu) Lysine (Lys) Proline (Pro) Asparagine (Asn) 0406 ACUGACUOROE (na) auone (aug) Giycine (Gly) Serine (Ser) Phenylalanine Glutamic acid (Glu) Aspartic acid (Asp) Histidine (His) Glutamine (Gin) Arginine (Arg) Isoleucine (lle) Methionine (Met) o Threonine (Thr)arrow_forwardWrite down the corresponding amino acids sequence for each mRNA sequence. Use the codon chart.arrow_forward
- Using the genetic code table provided below, identify the open reading frame in this mRNA sequence, and write out the encoded 9 amino acid long peptide sequence: 5'- CGACAUGCCUAAAAUCAUGCCAUGGAGGGGGUAACCUUUU C A G U UUU Phe UCU Ser UUC Phe UCC Ser UAC UCA Ser UAA UCG Ser UAG UUA Leu Leu G C CUU Leu CUC Leu CCC CUA Leu CUG Leu AUU lle AUC lle AUA lle AUG Met ACG ACU Thr ACC Thr ACA Thr Thr A UAU Tyr UGU Cys Tyr UGC Cys CCU Pro CAU His CGU Arg Pro CAC His Pro CAA Gln CGC Arg CGA Arg CCA CCG Pro CAG Gln CGG Arg GUU Val GCU Ala GAU GUC Val GCC Ala GAC GUA Val GCA Ala GAA GUG Val GCG Ala GAG Stop UGA Stop UGG AAU Asn AAC AAA AAG AGU Asn AGC G Lys Lys Asp Asp Glu Glu Stop A Trp Ser Ser AGA Arg AGG Arg GGU Gly GGC Gly UCAG GGA Gly GGG Gly с U C A G U C A G U C A Garrow_forwardDetermine which amino acid is formed from the following mRNA codon: GUA. a aspartic acid b glutamic acid c phenylalanine d valinearrow_forwardGiven the following DNA sequence: 3'-TACTTNGTNCTNTCN-5' where N stands for any nucleotide, give the complementary mRNA sequence. Indicate direction of strand as 3'--> 5' or 5'--> 3' as in the given sequence above. Give the amino acid sequence of your mRNA sequencelin No. 1. Indicate direction of strand as above. Use all lowercase letters, 3-letter name of amino acid separated by a hyphen (-), no spaces in-between.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning