Genetics: Analysis and Principles
6th Edition
ISBN: 9781259616020
Author: Robert J. Brooker Professor Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 13, Problem 24CONQ
Summary Introduction
To review:
The sequence that recognizes the 30S subunit in bacterial mRNA (messenger ribonucleic acid).
Introduction:
Prokaryotic cell consists of 70S ribosomes which has two units, namely, 50S which is the larger subunit and 30S subunit which is the smaller subunit. 50S subunit consists of 16S RNA (ribonucleic acid) and 21 proteins and 30S subunit consists 5S RNA, 23S RNA and 21 proteins.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Determine the amino acid sequence for a polypeptide coded for by the following mRNA transcript (written 5'-> 3'):
AUGCCUGACUUUAAGUAG
Provide the abbreviation for the amino acid sequence expected from the following mRNA segment using the
three-letter amino acid codes:
5' UUUICCCIAAUIAUUIACG 3'
For the following mRNA sequences, what is the amino acid sequence formed? Consult genetic code table for reference.
5' AGUCCGUAC 3'
5' AAUUGCUUC 3'
Chapter 13 Solutions
Genetics: Analysis and Principles
Ch. 13.1 - Prob. 1COMQCh. 13.1 - 2. The reason why Beadle and Tatum observed four...Ch. 13.2 - What is the genetic code? a. The relationship...Ch. 13.2 - Prob. 2COMQCh. 13.2 - The fourth codon in an mRNA sequence is GGG, which...Ch. 13.2 - Prob. 4COMQCh. 13.3 - Prob. 2COMQCh. 13.4 - Prob. 1COMQCh. 13.4 - 2. The anticodon of a tRNA is located in the
a....Ch. 13.4 - An enzyme known as _______attaches an amino acid...
Ch. 13.5 - Each ribosomal subunit is composed of a. multiple...Ch. 13.5 - Prob. 2COMQCh. 13.6 - 1. During the initiation stage of translation in...Ch. 13.6 - The Kozak rules determine a. the choice of the...Ch. 13.6 - During the peptidyl transfer reaction, the...Ch. 13.6 - A release factor is referred to as a molecular...Ch. 13 - Prob. 1CONQCh. 13 - What does it mean when we say that the genetic...Ch. 13 - According to the adaptor hypothesis, is each of...Ch. 13 - Prob. 4CONQCh. 13 - Prob. 5CONQCh. 13 - 6. The wobble rules for tRNA-mRNA pairing are...Ch. 13 - Prob. 7CONQCh. 13 - Prob. 8CONQCh. 13 - Prob. 9CONQCh. 13 - If a tRNA has an anticodon sequence 3CCI5, what...Ch. 13 - Describe the anticodon of a single tRNA that could...Ch. 13 - Prob. 12CONQCh. 13 - Prob. 13CONQCh. 13 - 14. What is the role of aminoacyl-tRNA synthetase?...Ch. 13 - Prob. 15CONQCh. 13 - 16. Discuss the significance of modified bases...Ch. 13 - How and when does formylmethionine become attached...Ch. 13 - Prob. 18CONQCh. 13 - Prob. 19CONQCh. 13 - Prob. 20CONQCh. 13 - The term subunit can be used in a variety of ways....Ch. 13 - 22. Do the following events during bacterial...Ch. 13 - 23. What are the three stages of translation?...Ch. 13 - Prob. 24CONQCh. 13 - 25. For each of the following initiation factors,...Ch. 13 - Prob. 26CONQCh. 13 - 27. For each of the following sequences, rank them...Ch. 13 - Prob. 28CONQCh. 13 - Prob. 29CONQCh. 13 - Prob. 30CONQCh. 13 - Prob. 31CONQCh. 13 - In which of the ribosomal sites, the A site, P...Ch. 13 - Prob. 33CONQCh. 13 - Prob. 34CONQCh. 13 - Prob. 35CONQCh. 13 - Prob. 36CONQCh. 13 - Prob. 37CONQCh. 13 - 1. In the experiment of Figure 13.7, what would be...Ch. 13 - 2. Polypeptides can be translated in vitro. Would...Ch. 13 - Discuss how the elucidation of the structure of...Ch. 13 - Describe the structure of a polysome, which is...Ch. 13 - Prob. 5EQCh. 13 - 6. The technique of Western blotting is described...Ch. 13 - The protein known as tyrosinase is needed to make...Ch. 13 - Prob. 8EQCh. 13 - Discuss why you think the ribosomes need to...Ch. 13 - 2. Discuss and make a list of the similarities...Ch. 13 - 3. Which events during translation involve...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Derive the amino acid sequence that is coded for by each of the following mRNA sequence. 5' CAA GAG GUA UCC UAC AGA 3' 5' GUC AUC UGG AGG GGC AUU 3' 5' CUA UGC AGU AGG ACA CCCarrow_forwardDescribe the recognition process by which the tRNA for Nformylmethionine interacts with the portion of mRNA that specifies the start of transcription.arrow_forwardDescribe the processing events that occur during the production of tRNA in E. coli.arrow_forward
- What is the peptide encoded by this mRNA sequence 5’-UCU-GCA- AAU-UAA -GUU-3’?arrow_forwardDraw a pre-mRNA with at least 4 exons and 3 introns and draw two possible mature mRNAs that can result from alternative splicing of this RNA.arrow_forwardPlease describe the four-step process of the elongation during protein translation in bacteria.arrow_forward
- Using the genetic code table provided below, identify the open reading frame in this mRNA sequence, and write out the encoded 9 amino acid long peptide sequence: 5'- CGACAUGCCUAAAAUCAUGCCAUGGAGGGGGUAACCUUUU C A G U UUU Phe UCU Ser UUC Phe UCC Ser UAC UCA Ser UAA UCG Ser UAG UUA Leu Leu G C CUU Leu CUC Leu CCC CUA Leu CUG Leu AUU lle AUC lle AUA lle AUG Met ACG ACU Thr ACC Thr ACA Thr Thr A UAU Tyr UGU Cys Tyr UGC Cys CCU Pro CAU His CGU Arg Pro CAC His Pro CAA Gln CGC Arg CGA Arg CCA CCG Pro CAG Gln CGG Arg GUU Val GCU Ala GAU GUC Val GCC Ala GAC GUA Val GCA Ala GAA GUG Val GCG Ala GAG Stop UGA Stop UGG AAU Asn AAC AAA AAG AGU Asn AGC G Lys Lys Asp Asp Glu Glu Stop A Trp Ser Ser AGA Arg AGG Arg GGU Gly GGC Gly UCAG GGA Gly GGG Gly с U C A G U C A G U C A Garrow_forwardA eukaryotic cell carrying out transcription and RNA processing is incubated with 32P-labeled ATP. Where will the radioactive isotope appear in mature mRNA if the ATP is labeled at the (a) α position, (b) β position, and (c) γ position?arrow_forwardWhat amino acid sequence does the following mRNA nucleotides sequence specify? 5'- AUGGCCAGCUGU -3' Express the sequence of amino axis's using the three-abbreviations, separate hyphens (e.g., Met-Ser-Thr-Lys-Gly).arrow_forward
- Explain why RISC binds to a specific mRNA. What type of bonding occurs?arrow_forwardOne of the codons in mRNA that specifies the amino acid phenylalanine is UUC. What is the anticodon on the tRNA that carries phenylalanine?arrow_forwardUsing the codon given for each amino acid (Find the table yourself) write the base sequence of mRNA that would translate the synthesis of the following pentapeptide:Arg · Ile · Cys · Tyr · Valarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Mitochondrial mutations; Author: Useful Genetics;https://www.youtube.com/watch?v=GvgXe-3RJeU;License: CC-BY