Which of the following interactions in E. coli ensures that the start codon of an mRNA is accurately positioned in a ribosome at the initiation of translation? O binding between the mRNA Shine-Dalgarno sequence and ribosomal proteins O base-pairing between the mRNA Shine-Dalgarno sequence and rRNA of the small ribosomal subunit O binding between ribosomal proteins and the initiation factor that base-pairs with the start codon O base-pairing between the mRNA Shine-Dalgarno sequence and rRNA of the large ribosomal subunit

Which of the following interactions in E. coli ensures that the start codon of an mRNA is accurately positioned in a ribosome at the initiation of translation? O binding between the mRNA Shine-Dalgarno sequence and ribosomal proteins O base-pairing between the mRNA Shine-Dalgarno sequence and rRNA of the small ribosomal subunit O binding between ribosomal proteins and the initiation factor that base-pairs with the start codon O base-pairing between the mRNA Shine-Dalgarno sequence and rRNA of the large ribosomal subunit

Name: Which of the following interactions in E. coli ensures that the start
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Which of the following interactions in E. coli ensures that the start codon of an mRNA is accurately positioned in a ribosome at the initiation of translation?O binding between the mRNA Shine-Dalgarno sequence and ribosomal proteinsbase-pairing betw

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 16QP: Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also,...

See similar textbooks

Similar questions

Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
A certain mRNA strand has the following nucleotide sequence: 5AUGACGUAUAACUUU3 What is the anticodon for each codon? What is the amino acid sequence of the polypeptide? (Use Figure 13-5 to help answer this question.) Figure 13-5 The genetic code The genetic code specifies all possible combinations of the three bases that compose codons in mRNA. Of the 64 possible codons, 61 specify amino acids (see Figure 3-17 for an explanation of abbreviations). The codon AUG specifies the amino acid methionine and also signals the ribosome to initiate translation (start). Three codonsUAA, UGA, and UAGdo not specify amino acids; they terminate polypeptide synthesis (stop).
Which of these statements is true about the elongation step of translation? The growing polypeptide chain is transferred from the P site RNA to the A site RNA OThe MRNA moves through the ribosome OThe new amino acid is transferred from the A site tRNA to the growing polypeptide chain in the P site The small ribosomal subunit detaches and reattaches every time a new amino acid is incorporated into the growing polypeptide
Which of the following statements about translation is false? In eukaryotes, the 5' cap and the 3' poly(A) tail are involved in translation initiation. Peptidyl-transferase activity during translation is the property of a ribozyme. A base at the first position of an anticodon on the tRNA would pair with a base at the third position of the mRNA. The growing peptide chain is transferred from the tRNA in the P site to the tRNA in the A site. Ribosomes move along an mRNA in the 3’ → 5' direction.
Using the following list of codons describe, using diagrams etc., how information stored in the DNA is translated into a peptide. Be sure to discuss all steps. In other words, use a diagram and give me sequences, transcription and translation steps. Show the sequences of the sense and the other DNA strand, the mRNA and the tRNA’s. UUU -phenylalanine UCU -serine AUG –initiation/methionine CUU -leucine ACU -threonine GUU -valine UAA -Termination
Which of these statements is true about the elongation step of translation? The growing polypeptide chain is transferred from the P site RNA to the A site RNA The MRNA moves through the ribosome The new amino acid is transferred from the A site RNA to the growing polypeptide chain in the P site The small ribosomal subunit detaches and reattaches every time a new amino acid is incorporated into the growing polypeptide
Which of the following best describes a sequence of events that happens during the elongation phase of translation? Group of answer choices A charged tRNA enters the P site of a ribosome; a tRNA bound to a peptide moves to the A site; an tRNA bound to a peptide exits the E site. None of these is an accurate description A charged tRNA enters the A site of a ribosome; a tRNA bound to a peptide moves to the P site; an uncharged tRNA exits the E site. An uncharged tRNA enters the A site of a ribosome; a tRNA bound to a peptide moves to the P site; a charged tRNA exits the E site. A charged tRNA enters the A site of a ribosome; a tRNA bound to a peptide moves to the E site; an tRNA bound to a peptide exits the A site.
The initial step in the protein translation is described by: release of the initiation factors upon assembly of the initiation complex binding of mRNA to the smaller subunit of the ribosome delivery of an aminoacyl-tRNA to the A site of the ribosome formation of the aminoacyl-tRNA
Drag the functions involved in the bacterial translation process into the appropriate box with the corresponding name of the translation factor or component. Reset Help Prevents premature association of the large ribosomal subunit with the small Serves as the MRNA binding site for Guides the initiator fMet-tRNA into the the small ribosomal subunit. P site. ribosomal subunit. Prevents entry of an amino-acyl tRNA into the ribosome A site during the early initiation stages. Assists incoming amino-acyl RNA into the A site. IF1 IF2 IF3 EF-Tu Shine-Dalgarno sequence
Which of the following events would NOT result in ribosomes stalling on an MRNA during translation? The MRNA in a given region is very highly folded, and the ribosome stalls because the RNA structure blocks its movement. O The correct tRNA is scarce because it is not transcribed very much in the prevailing conditions. The ribosome stalls while waiting for one of the scarce tRNAS to diffuse into the A site. O the release tactor enters the A site, decodes a stop codon and transfers an oxxYgen from water to the carboxyl group of the peptidyl-tRNA in the P site, causing stalling O Starvation for amino acids will reduce the amount of amino-acylated (charged) tRNA the ribosome will stall while waiting for a charged tRNA to enter the A site to decode the next codon
The piece of eukaryotic mRNA below includes the region that codes for the binding site for the initiator tRNA needed in translation. 5'-GUUUCCCGUAUACAUGCGUGCCGGGGGC-3' Using the table below, which amino acid would you expect to be on the tRNA that is the first to bind to the A site of the ribosome? AGC AGA AGG GCA CGA CUA GGA GGC GCC CGC AUA CUC AGU CCA UCA ACA CCC UCC ACC UUC CCG UCG ACG UUU CCU UCU GCG CGG GAC AAC UGC GAA CAA GGG CAC AUC CUG AAA GCU CGU GAU AAU UGU GAG CAG GGU CAU AUU CUU AAG AUG Ala Arg Asp Asn Cys Glu Gin Gly His lle Leu Lys Met Phe Pro Ser O methionine O arginine O cysteine Ovaline UUA UUG OOOO GUA GUC UAC GUG ACU UGG UAU GUU Thr Trp Tyr Val UAA UAG UGA stop
A fragment of a polypeptide, Met-Thr-Ile-Ser-Asp-Ile is encoded by the following sequence of DNA:Strand A - TACGATGACGATAAGCGACATAGC - Strand B - ATGCTACTGCTATTCGCTGTATCG -Which is the transcribed (template) strand? Write the sequence of the resulting mRNA transcript. Add labels to the strands above to show the 3’ and 5’ ends.