Genetics: Analysis and Principles
6th Edition
ISBN: 9781259616020
Author: Robert J. Brooker Professor Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 13, Problem 20CONQ
Summary Introduction
To review:
Ribosomal subunit component for a eukaryotic cell. Subunit assembly location within the cell.
Introduction:
Eukaryotic cell is a highly complex structure as different organelles are found in it. Some organelles have a membrane while some do not. In eukaryotic cell, 80S ribosomes are present while in prokaryotic cell 70S ribosomes are present.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
What is the difference between eukaryotes and prokaryotes in terms of ribosomal subunit binding?
Describe the function of the A, P, and E sites of a typical ribosome.
Explain why a 50S ribosomal subunit and a 30S ribosomal subunit combine to form a 70S subunit, instead of an 80S subunit
Chapter 13 Solutions
Genetics: Analysis and Principles
Ch. 13.1 - Prob. 1COMQCh. 13.1 - 2. The reason why Beadle and Tatum observed four...Ch. 13.2 - What is the genetic code? a. The relationship...Ch. 13.2 - Prob. 2COMQCh. 13.2 - The fourth codon in an mRNA sequence is GGG, which...Ch. 13.2 - Prob. 4COMQCh. 13.3 - Prob. 2COMQCh. 13.4 - Prob. 1COMQCh. 13.4 - 2. The anticodon of a tRNA is located in the
a....Ch. 13.4 - An enzyme known as _______attaches an amino acid...
Ch. 13.5 - Each ribosomal subunit is composed of a. multiple...Ch. 13.5 - Prob. 2COMQCh. 13.6 - 1. During the initiation stage of translation in...Ch. 13.6 - The Kozak rules determine a. the choice of the...Ch. 13.6 - During the peptidyl transfer reaction, the...Ch. 13.6 - A release factor is referred to as a molecular...Ch. 13 - Prob. 1CONQCh. 13 - What does it mean when we say that the genetic...Ch. 13 - According to the adaptor hypothesis, is each of...Ch. 13 - Prob. 4CONQCh. 13 - Prob. 5CONQCh. 13 - 6. The wobble rules for tRNA-mRNA pairing are...Ch. 13 - Prob. 7CONQCh. 13 - Prob. 8CONQCh. 13 - Prob. 9CONQCh. 13 - If a tRNA has an anticodon sequence 3CCI5, what...Ch. 13 - Describe the anticodon of a single tRNA that could...Ch. 13 - Prob. 12CONQCh. 13 - Prob. 13CONQCh. 13 - 14. What is the role of aminoacyl-tRNA synthetase?...Ch. 13 - Prob. 15CONQCh. 13 - 16. Discuss the significance of modified bases...Ch. 13 - How and when does formylmethionine become attached...Ch. 13 - Prob. 18CONQCh. 13 - Prob. 19CONQCh. 13 - Prob. 20CONQCh. 13 - The term subunit can be used in a variety of ways....Ch. 13 - 22. Do the following events during bacterial...Ch. 13 - 23. What are the three stages of translation?...Ch. 13 - Prob. 24CONQCh. 13 - 25. For each of the following initiation factors,...Ch. 13 - Prob. 26CONQCh. 13 - 27. For each of the following sequences, rank them...Ch. 13 - Prob. 28CONQCh. 13 - Prob. 29CONQCh. 13 - Prob. 30CONQCh. 13 - Prob. 31CONQCh. 13 - In which of the ribosomal sites, the A site, P...Ch. 13 - Prob. 33CONQCh. 13 - Prob. 34CONQCh. 13 - Prob. 35CONQCh. 13 - Prob. 36CONQCh. 13 - Prob. 37CONQCh. 13 - 1. In the experiment of Figure 13.7, what would be...Ch. 13 - 2. Polypeptides can be translated in vitro. Would...Ch. 13 - Discuss how the elucidation of the structure of...Ch. 13 - Describe the structure of a polysome, which is...Ch. 13 - Prob. 5EQCh. 13 - 6. The technique of Western blotting is described...Ch. 13 - The protein known as tyrosinase is needed to make...Ch. 13 - Prob. 8EQCh. 13 - Discuss why you think the ribosomes need to...Ch. 13 - 2. Discuss and make a list of the similarities...Ch. 13 - 3. Which events during translation involve...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Explain the function of spliceosomes in eukaryotic cells. The following sequence represents pre-mRNA derived from a gene coding for alpha keratin in birds. Label the sequence to show potential exon(s), intron(s) and spliceosome cut site(s). That is, put the intron(s) sequences in parentheses and use black slash symbols (/) to indicate the spliceosome cut site(s). What is the sequence of the mature MRNA after splicing? [ 5' AUGGGUUUAGGACCCCCGAUAAA 3'arrow_forwardIf DNA codes for mRNA and mRNA codes for protein, then how can the same DNA sequence generate different proteins? What are the 3 tRNA sites on the small ribosomal subunit (just abbreviations)? What is the order of tRNA entrance and exit through the ribosome?arrow_forwardIn the: Inhibition of splicing by ribozymes Explain: (a) What is the process affected? (b) What is the Effect on the process? (c) Does it affect prokaryotes, eukaryotes or both?arrow_forward
- Indicate the amino acid sequence of the protein encoded by the following mRNA molecule. Use the genetic code table and assume that the very first “AUG” the ribosome encounters will serve as the start codon and specify methionine. 5’-AAUUCAUGCCCAAAUUUGGGGCACGAAGCUUCUUAGGCUAGUCCUAAAAAA-3’arrow_forwardA segment of DNA has the followimg sequence of bases.. 5'-ATGCAATGATATTGAAGCTTA-3' a) What sequence of bases would appear in mRNA transcribed from this segment? b) Assume the first base in this mRNA is the beginning of a codon. What order of amino acid would be translated into a polypeptide synthesized along this segment? c) Give anticodons for each tRNA associated with the translation in part (b)arrow_forwardCompare and contrast the subunits of prokaryotic and eukaryotic ribosomes. What is the important application of this difference?arrow_forward
- The BSA precursor protein is 607 amino acids long and has a molecular weight 69.324 kDa. If a eukaryotic ribosome can synthesize an amino acid chain at 2 amino acids/sec, how many seconds would it take for 107 ribosomes to produce 1 pg of BSA precursor?arrow_forwardEF-G is a macromolecular mimic of EF-tu. It's role in translation is to To cause the large subunit of the ribosome to disassociate with the small subunit of the ribosome Bind to the vacant A-site subsequent to peptide bond formation and resolve the hybrid state of the ribosome To recruit the signal recognition particle (SRP) to the ribosome and to facilitate synthesis of membrane proteins O To cause the large subunit to associate with the small subunit of the ribosome Shuttle an amino-acylated tRNA to the A site to initiate the peptidyl transfer reactionarrow_forwardExplain briefly how translation is initiated from a) prokaryotic mRNA and b) eukaryotic mRNA. Include names of any relevant sequences on the mRNA, proteins involved, including ribosomal subunits.arrow_forward
- The antibiotic chloramphenicol binds the 50S large subunit of a ribosome as shown (the light gray area is the large subunit, while the black shape is the drug). Based on the diagram, what can you conclude about how the chloramphenicol behaves as an antibiotic?arrow_forwardExplain why prokaryotic ribosomes can translate a circular mRNA molecule, whereas eukaryotic ribosomes normally cannot, even in the presence of the required cofactors.arrow_forwardDuring the biosynthesis of ribosomes, rRNA synthesized in the (fill in) Nuclear membrane nucleolus Cytoplasm Nuclear pore complex And Ribosomal proteins are assembled together into the rirbosomal subunits which are then shipped to the cytoplasm where mature ribosomes are finally assembled. Free ribosomes are localized in the cytoplasm and synthesize cytoplasmic proteins such as [ans2]. While no protein synthesis takes place in the sER, it is an important site for the synthesis of (fill in) DNA tyrosine kinase receptors alcohol integrins tubulin proton pumps RNA phospholipids The sER plays also an important role in detoxification of different types of drugs, which is why ( fill in) Liver Bone Brain skin cells display a large sER. In addition, the sER functions as a reservoir for the storage of (fill in) Iron Iodine Calcium Sodium Ions in many type of cellsarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Biology - Intro to Cell Structure - Quick Review!; Author: The Organic Chemistry Tutor;https://www.youtube.com/watch?v=vwAJ8ByQH2U;License: Standard youtube license