Genetics: Analysis and Principles
6th Edition
ISBN: 9781259616020
Author: Robert J. Brooker Professor Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 13, Problem 27CONQ
For each of the following sequences, rank them in order (from best to worst) as sequences that could be used to initiate translation according to Kozak’s rules.
GACGCCAUGG
GCCUCCAUGC
GCCAUCAAGG
GCCACCAUGG
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start):
5’- GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’
By in vitro translating the mRNA, you determined that the translated peptide is 15 amino acids long. What is the expected peptide sequence in single letter abbreviations?
Translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the first base:
5’ - UGUCAUGCUCGUCUUGAAUCUUGUGAUGCUCGUUGGAUUAAUUGU - 3’
For each of the following sequences, rank them in order (from best to worst) as sequences that could be used to initiate translation according to Kozak’s rules.
GACGCCAUGG
GCCUCCAUGC
GCCAUCAAGG
GCCACCAUGG
Chapter 13 Solutions
Genetics: Analysis and Principles
Ch. 13.1 - Prob. 1COMQCh. 13.1 - 2. The reason why Beadle and Tatum observed four...Ch. 13.2 - What is the genetic code? a. The relationship...Ch. 13.2 - Prob. 2COMQCh. 13.2 - The fourth codon in an mRNA sequence is GGG, which...Ch. 13.2 - Prob. 4COMQCh. 13.3 - Prob. 2COMQCh. 13.4 - Prob. 1COMQCh. 13.4 - 2. The anticodon of a tRNA is located in the
a....Ch. 13.4 - An enzyme known as _______attaches an amino acid...
Ch. 13.5 - Each ribosomal subunit is composed of a. multiple...Ch. 13.5 - Prob. 2COMQCh. 13.6 - 1. During the initiation stage of translation in...Ch. 13.6 - The Kozak rules determine a. the choice of the...Ch. 13.6 - During the peptidyl transfer reaction, the...Ch. 13.6 - A release factor is referred to as a molecular...Ch. 13 - Prob. 1CONQCh. 13 - What does it mean when we say that the genetic...Ch. 13 - According to the adaptor hypothesis, is each of...Ch. 13 - Prob. 4CONQCh. 13 - Prob. 5CONQCh. 13 - 6. The wobble rules for tRNA-mRNA pairing are...Ch. 13 - Prob. 7CONQCh. 13 - Prob. 8CONQCh. 13 - Prob. 9CONQCh. 13 - If a tRNA has an anticodon sequence 3CCI5, what...Ch. 13 - Describe the anticodon of a single tRNA that could...Ch. 13 - Prob. 12CONQCh. 13 - Prob. 13CONQCh. 13 - 14. What is the role of aminoacyl-tRNA synthetase?...Ch. 13 - Prob. 15CONQCh. 13 - 16. Discuss the significance of modified bases...Ch. 13 - How and when does formylmethionine become attached...Ch. 13 - Prob. 18CONQCh. 13 - Prob. 19CONQCh. 13 - Prob. 20CONQCh. 13 - The term subunit can be used in a variety of ways....Ch. 13 - 22. Do the following events during bacterial...Ch. 13 - 23. What are the three stages of translation?...Ch. 13 - Prob. 24CONQCh. 13 - 25. For each of the following initiation factors,...Ch. 13 - Prob. 26CONQCh. 13 - 27. For each of the following sequences, rank them...Ch. 13 - Prob. 28CONQCh. 13 - Prob. 29CONQCh. 13 - Prob. 30CONQCh. 13 - Prob. 31CONQCh. 13 - In which of the ribosomal sites, the A site, P...Ch. 13 - Prob. 33CONQCh. 13 - Prob. 34CONQCh. 13 - Prob. 35CONQCh. 13 - Prob. 36CONQCh. 13 - Prob. 37CONQCh. 13 - 1. In the experiment of Figure 13.7, what would be...Ch. 13 - 2. Polypeptides can be translated in vitro. Would...Ch. 13 - Discuss how the elucidation of the structure of...Ch. 13 - Describe the structure of a polysome, which is...Ch. 13 - Prob. 5EQCh. 13 - 6. The technique of Western blotting is described...Ch. 13 - The protein known as tyrosinase is needed to make...Ch. 13 - Prob. 8EQCh. 13 - Discuss why you think the ribosomes need to...Ch. 13 - 2. Discuss and make a list of the similarities...Ch. 13 - 3. Which events during translation involve...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Using the genetic code table provided below, write out the sequence of three different possible mRNA sequences that could encode the following sequence of amino acids: Met-Phe-Cys-Trp-Glu C A G U C UUU Phe UCU Ser UUC Phe UCC Ser UCA Ser UUA Leu UUG Leu UCG Ser CUU Leu CCU Pro CUC Leu CUA Leu CUG Leu CCG A CAU His CGU Arg CCC Pro CAC His CGC Arg UAU Tyr UGU Cys U UAC Tyr UGC Cys C Stop UGA Stop Stop UGG Trp UAA A UAG G CCA Pro CAA Gln Pro CAG AUU lle AUC lle AUA lle AUG Met ACG G 등등 Gln CGA Arg CGG Arg ACU Thr AAU Asn AGU Ser ACC AAC Asn AGC Ser Thr ACA Thr Thr AAA Lys AGA Arg AAG Lys AGG Arg GUU Val GCU Ala GAU Asp GGU Gly GGC Gly GUC Val GCC Ala GAC Asp GUA Val GCA Ala GAA Glu GGA Gly GUG Val GCG Ala GAG Glu GGG Gly U C A G U C A G SUAUarrow_forwardTranslate the following mRNA nucleotide sequence into an amino acid sequence, starting at the second base: 5’ - UGUCAUGCUCGUCUUGAAUCUUGUGAUGCUCGUUGGAUUAAUUGU - 3’arrow_forwardIn the human genome for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotide in the amino acid coding region is represented by the sequence 3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5'arrow_forward
- For the following sequence please design an 18 base pair REVERSE primer. ATGGCTGATAAGATAGAGAGGCATACTTTCAAGGTCTTCAATCAAGATTTCGAAAAAGAGCTGGAGTTTGGATTAGATAGAAAATATTTTTAGarrow_forwardSuppose the codon sequence GUGCAAUUCGAGGCC has a single base pair mutation to GUGCAAUUCAAGGCC. If the old protein sequence was Val-Gln-Phe-Glu-Ala, what will be the new sequence encoded by the mutant gene? ____________________________.arrow_forwardThe following RNA sequence represents a small messenger which can be translated in a prokaryotic cell: 5'-ACGAAUGCACAGUAAAACUGGCUAGCGUAGGCUGA-3 Assume that the messenger RNA is translated in the cell, using the correct machinery and signals required for accurate protein synthesis. Using this RNA sequence and the Genetic Code Dictionary (see your textbook for the dictionary), solve the following problems A. Write the sequence of a protein that would be translated from this mRNA, using the appropriate stop and start signals, and indicating the correct termini of the protein product. B. Suppose that the underlined A in the sequence is changed to a U. Write the expected protein product of this mRNA.arrow_forward
- Using the genetic code table provided below, identify the open reading frame in this mRNA sequence, and write out the encoded 9 amino acid long peptide sequence: 5'- CGACAUGCCUAAAAUCAUGCCAUGGAGGGGGUAACCUUUU C A G U UUU Phe UCU Ser UUC Phe UCC Ser UAC UCA Ser UAA UCG Ser UAG UUA Leu Leu G C CUU Leu CUC Leu CCC CUA Leu CUG Leu AUU lle AUC lle AUA lle AUG Met ACG ACU Thr ACC Thr ACA Thr Thr A UAU Tyr UGU Cys Tyr UGC Cys CCU Pro CAU His CGU Arg Pro CAC His Pro CAA Gln CGC Arg CGA Arg CCA CCG Pro CAG Gln CGG Arg GUU Val GCU Ala GAU GUC Val GCC Ala GAC GUA Val GCA Ala GAA GUG Val GCG Ala GAG Stop UGA Stop UGG AAU Asn AAC AAA AAG AGU Asn AGC G Lys Lys Asp Asp Glu Glu Stop A Trp Ser Ser AGA Arg AGG Arg GGU Gly GGC Gly UCAG GGA Gly GGG Gly с U C A G U C A G U C A Garrow_forwardRepresentations of sequencing chromatograms for variants of the a chain of human hemoglobin are shown here. Match each of the variants with the corresponding amino acid change. You can use the codon table to decode each amino acid sequence. For example, the first triplet encodes for Val. Normal Chongqing ddATP ddCTP ddGTP ddTTP Pro to Thr Gly to Asp Leu to Arg Karachi Swan River Answer Bank Ala to Pro Asp to Gly Pro to Ala Arg to Leu Asp to Asn Arg to Valarrow_forwardFor the following sequence please design an 18 base pair forward primer. ATGGCTGATAAGATAGAGAGGCATACTTTCAAGGTCTTCAATCAAGATTTCGAAAAAGAGCTGGAGTTTGGATTAGATAGAAAATATTTTTAGarrow_forward
- In the copies of each sequence below, divide the sequences into codons (triplets) by putting a slash between each group of three bases. Sequence ATCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGCCGCCAGGGCCCCGCCCCTCAGAAGTTGGTSequence BTCAGACGTTTTTGCCCCGTAACAACTTGTTACAACATGGTCATAAACGTCAGAGATGGTCAATCTCTTAATGACTSequence CTACAAACATGTAAACACACCCTCAGTGGACCAACTCCGCAACATAAACCAAACACCGCTCGCGCCGAAAAAGATATGGarrow_forwardA portion of the sequence from the DNA coding strand of the chick ovalbumin gene is shown. Determine the partial amino acid sequence of the encoded protein. CTCAGAGTTCACCATGGGCTCCATCGGTGCAGCAAGCATGGAA-(1104 bp)-TTCTTTGGCAGATGTGTTTCCCCTTAAAAAGAA Enter the 3-letter abbreviation for each amino acid in sequence, separated with dashes, and no spaces (example: xxx-xxx-XXX-XXX...) The amino acid sequence is .1104bp..…........arrow_forwardFor the following sequence, what is the Tm? 5'-AGCTACGATCAGGTCA-3'arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
What is Genomics - Full Length; Author: Genome BC;https://www.youtube.com/watch?v=mmgIClg0Y1k;License: Standard youtube license