A segment of DNA has the followimg sequence of bases.. 5'-ATGCAATGATATTGAAGCTTA-3' a) What sequence of bases would appear in mRNA transcribed from this segment? b) Assume the first base in this mRNA is the beginning of a codon. What order of amino acid would be translated into a polypeptide synthesized along this segment?  c) Give anticodons for each tRNA associated with the translation in part (b)

A series of tRNAs have the following anticodons. Consider the wobble rules listed in Table  and give all possible codons with which each tRNA can pair. Q. 5′ –IAA–3′

First base of RNA codon Provide the sequence of amino acids that would be translated from the following strand of RNA. Use the chart provided below: Second base of RNA codon U A UUU UCU UAU UGU Phenylalanine Tyrosine Cysteine UUC (Phe) UCC UAC (Tyr) UGC (Cys) C U Serine UUA UCA (Ser) UAA Stop UGA Stop Leucine UUG (Leu) UCG UAG Stop UGG Tryptophan (Trp) G CUU CCU CAU CGU Histidine CUC CCC CAC (His) CGC 0 Leucine Proline Arginine CUA (Leu) CCA (Pro) CAA CGA (Arg) Glutamine CUG CCG CAG (Gln) CGG AUU ACU AAU AGU Asparagine Serine AUC Isoleucine ACC AAC (Asn) AGC (Ser) A (lle) Threonine AUA ACA (Thr) AAA AGA Lysine Arginine AUG Met or start ACG AAG (Lys) AGG (Arg) GUU GCU GAU GGU Aspartic GUC GCC GAC acid (Asp) GGC G Valine Alanine Glycine GUA (Val) GCA (Ala) GAA GGA (Gly) Glutamic GUG GCG GAG acid (Glu) GGG AUGGGC CUAGGAUUUCCAACCUAG Edit View Insert Format Tools Table 12pt Paragraph BI U T² : Third base of RNA codon

For a DNA template strand containing the sequence 3'AATTGGCC 5', what is the sequence of nucleotides from the 5' to the 3' end in the mRNA transcript?

For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’, what is the sequence of the corresponding segment of mRNA formed using the DNA segment above as the template?