Consider the following segment of DNA, which is part ofa much longer molecule constituting a chromosome:5′.…ATTCGTACGATCGACTGACTGACAGTC….3′3′.…TAAGCATGCTAGCTGACTGACTGTCAG….5′If the DNA polymerase starts replicating this segmentfrom the right,a. which will be the template for the leading strand?b. Draw the molecule when the DNA polymerase ishalfway along this segment.c. Draw the two complete daughter molecules.d. Is your diagram in part b compatible with bidirectional replication from a single origin, the usual modeof replication?

The first 15 bases of the original coding informational strand of DNA (which continues after what is shown) are 5-ATGAAACCCGGGTTT(...)-3'. Which of the following mutations to this original strand would be silent and which would likely only have a small effect on the coded protein? (Again, only the first 15 bases of the DNA strand are shown, even though they continue on. HINT: To solve this, you might write out the template DNA strand, the mRNA strand that would be made, and the resulting amino acids for the start of the protein.) Mutation #1: 5-ATGAAAGCCCGGGTT(...)-3' Mutation #2: 5-ATGAACCCCGGGTTT(...)-3' Mutation #3: 5-ATGAACCCGGGTTTA(...)-3' Mutation #4: 5-ATGAAGCCCGGGTTT(...)-3' Mutation #5: 5-ATGTAACCCGGGTTT(...)-3'

a. What DNA sequences are found at the telomeresof human chromosomes?b. What functions do the two telomere-associatedcomplexes, telomerase and shelterin, fulfill at chromosome ends?c. Where do you think that the RNA component oftelomerase comes from?

Consider the following segment of DNA, which is part of a linear chromosome: LEFT            5’.…TGACTGACAGTC….3’ 3’.…ACTGACTGTCAG….5’                    RIGHT   During DNA replication, this double-strand molecule is separated from the right to the left into two single strands and the replisome is moving from the right to the left of the segment. ___________ should be the template for the lagging strand synthesis.     neither of the two strands   the bottom strand   both top and bottom strands   the top strand

5’ GGACCTATCAAAATCCTTAATGCGCTAGGATAGCTAACGCATCCAC3’ Fill in the complimentary DNA strand and label the polarity (the 5’ and 3’ ends)

Which of the following DNAs is most likely to contain the recognition sequence for a homodimeric DNA binding protein? (Note that only one strand of the DNA is shown - you will find it helpful to write down the sequence and the sequence of the opposite strand to answer this question.) a) 5’- G A G C G A T C G C T C - 3’ b) 5’- G A G C G A G A G C G A - 3’ c) 5’- G A G C G A A G C G A G - 3’

1) A bacterial chromosome contains 6.4 million nucleotides of DNA. If synthesis at each replication fork occurs at a rate of 1800 nucleotides per second, how many minutes will it take to completely replicate the chromosome with theta replication? 2) What different mRNA sequences can code for a polypeptide chain with the amino acid sequence Met-Trp-Ile? (Include the stop codon)

Helicases are crucial to many of the molecular biological processes we have learned about in this class. Briefly (2-3 sentences max), describe what a helicase does and give 2 examples of different processes (replication, repair, transcription, and translation) that helicases are involved in what it does in each process.   A) What does a helicase do?  B) Example 1  C) Example 2

Imagine a cell had a version of helicase that was permanently stuck at the origin of replication. Would this be considered a dominant negative mutant and why? Only one of the explanations below is correct (not counting the yes/no answer choice) O ..since it will prevent normal helicases from functioning. Yes... ...because there would be excess DNA replication. O..only if it was the only version of helicase in the cell. No... O ..because it is an inactive protein.

You are studying a colony of cells and determine that some of these cells have a mutated DNA polymerase I that results in loss of function of this enzyme. A)   What will the effect of the mutation in DNA polymerase I be on DNA replication? In your answer make sure to describe what would be observed in the leading and lagging strand and explain your reasoning.  B)   Will this mutation in DNA polymerase I have an impact on another step in DNA replication? In your answer make sure to indicate whether DNA replication will be impacted or not. If it is not, explain why. If it is impacted, then describe the step that is impacted and name the molecule or enzyme involved.