A K I D H

There are 2 parts to this question: The following DNA strand (below) is about to undergo DNA replication. a) Please replicate the parental strands into two exact copies TC GATATCGG AGCTATAGCC b) place a centromere between the two replicated copies (or tell me where the centromere would be located),

To test patients for COVID19, lab workers will first convert all the RNA molecules extracted from a nasal swab to a double-stranded DNA copy (dsDNA). If the virus is present, its genomic sequence should be in some of the new dsDNA molecules. Part 1) A region of COVID genomic DNA sequence is shown below. Following convention, only the top strand is shown. Copy/paste the sequence into the text box and create the second strand. Be sure to label its ends. (You may need to reduce the font size so that it doesn't wrap around) AAGATCACATTGGCACCCGCAATCCTGCTAACAATGCTGCAATCGTGCTACAACTTCCTC Part 2) To test for the presence of COVID DNA sequence, lab workers use single-stranded DNA oligonucleotides as probes (short pieces of DNA that do not have a partner strand). If the two strands of DNA that you drew were separated from each other, where would the shorter DNA strand shown below be able to form continuous base pairs? Highlight that region in your dsDNA model. TGTAGCACGATTGCAGCATTG Note: If you…

Label the diagram to the corresponding letter

Choose the correct gel electrophoretic pattern that would be seen in dideoxy sequence analysis of the DNADNA molecule shown below. pGGCGACCGATTAGTCCCATCGATGGG−OH

please dont give hand writting solution please

The line below depicts a DNA segment from a eukaryote. In this case, only the top, coding strand, is shown which is ok for our purposes (but remember that the other strand would also be present in DNAà but it is ok for us to ignore). This is very similar to a problem on the old tests. For each letter state the structure or the function of what occurs at that region.                  Letter A is   Letter B is   Letter C is   Letter D is   Letter E is   Letter F is   Letter G is   To which region/letter would RNA Polymerase bind   To which region/letter GTF bind   Label the position of the start codon ATG and the stop codon TGA The picture below is for the question itself

In the drawing shown below, the top strand (purple) is the template DNA, and the bottom shows the synthesis of the lagging strand (DNA in blue and RNA primers in red). 3' 5" ыш Left Okazaki fragment --- -11-- Middle Okazaki fragment Right Okazaki fragment 5' 3' After DNA polymerase I removes the middle primer and fills in with DNA, where is DNA ligase needed? See the arrows on both sides of the middle primer. Explain whether ligase is needed at the left arrow, at the right arrow, or both?

Given the following template DNA strand, what is the correct complementary DNA sequence? 3' CGC AGT GGA CAT TTC 5'

a) Identify and explain at least five things wrong with image.