A solution contains DNA polymerase and the Mg ²+ salts of dATP, dGTP, dCTP, and TTP. The following DNA molecules are added to aliquots of this solution. Which of them would lead to DNA synthesis? (a) A single-stranded closed circle containing 1000 nucleotide units. (b) A double-stranded closed circle containing 1000 nucleotide pairs. (c) A single-stranded closed circle of 1000 nucleotides base-paired to a linear strand of 500 nucleotides with a free 3' -OH terminus. (d) A double-stranded linear molecule of 1000 nucleotide pairs with a free 3’-OH group at each end.

A solution contains DNA polymerase and the Mg ²+ salts of dATP, dGTP, dCTP, and TTP. The following DNA molecules are added to aliquots of this solution. Which of them would lead to DNA synthesis? (a) A single-stranded closed circle containing 1000 nucleotide units. (b) A double-stranded closed circle containing 1000 nucleotide pairs. (c) A single-stranded closed circle of 1000 nucleotides base-paired to a linear strand of 500 nucleotides with a free 3' -OH terminus. (d) A double-stranded linear molecule of 1000 nucleotide pairs with a free 3’-OH group at each end.

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter8: The Structure, Replication, And Chromosomal Organization Of Dna

Section: Chapter Questions

Problem 14QP: State the properties of the WatsonCrick model of DNA in the following categories: a. number of...

See similar textbooks

Similar questions

DNA contains many hydrogen bonds. Are hydrogen bonds stronger or weaker than covalent bonds? What are the consequences of this difference in strength?
State the properties of the WatsonCrick model of DNA in the following categories: a. number of polynucleotide chains b. polarity (running in same direction or opposite directions) c. bases on interior or exterior of molecule d. sugar/phosphate on interior or exterior of molecule e. which bases pair with which f. right- or left-handed helix
(a) (b) (c) The figure shown below is the mechanism of a DNA nuclease. The DNA molecule is in blue while the protein residues are in black (M1 and M2 are metal ions, they are irrelevant to this question). 3' Base reaction. M² 5' 00 3' Glu 357 M¹ Draw the structure of the final DNA product for this reaction. Draw a square around the nucleophile and draw a circle around the leaving group in this Does this depict the reaction of an endonuclease or an exonuclease?
The base composition of one of the DNA chains of a DNA double helix contains 18 mol-%A, 35 mol-%T, 26 mol-%C, and 21 mol-%G (a) What is the base composition of the complementary DNA chain? (b) Is the total amount of purine bases equal to the total amount of pyrimidine bases for the DNA double helix?
Write the sequence of the complementary DNA strand thatpairs with each of the following DNA base sequences:(a) GGTTAC(b) CCCGAA
The melting temperature Tm of DNA can be predicted by calculation without actually measuring it. Calculate the Tm of the DNA double strand shown in (1) to (3), and discuss the results. The numbers in parentheses indicate the degree of polymerization of nucleotides.(1) A(10) + T(10), (2) A(15) + T(15), (3) G(10) + C(10)
2) When DNA is placed in distilled water, which is pH 7.0, it denatures (i.e., the two strands separate). The pH inside a cell is generally 7.2-7.5, depending on the organism, but DNA is generally double-stranded under physiological conditions. Briefly explain, in your own words, why DNA denatures when placed in distilled water but not when it is inside a cell. [Reminder: the pKa for the phosphate groups in the sugar-phosphate backbone of a strand of DNA is 2.14]
For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’ Write: a) the sequence of the complementary DNA strand
Given the following eukaryotic DNA strand, transcribe and translate the DNA into a polypeptide using the 3’ – 5’ strand as the template. You may use drawings, diagrams, colours and annotations to describe how the DNA strand will be synthesized into a functional protein. (32) (KEY: The letters SBMD are “made up” nucleic acids that depict non-coding regions in the DNA, hypothetically S pairs with B and M pairs with D). 5’ - TATAAAAASSMSBMDATGSBDCCMBDBAATBSMDSTGTGTCCTMSBAG – 3’
A circular, double-stranded DNA contains 2100 base pairs. The solution conditions are such that DNA has 10.5 bp/turn. (a) What is Lo for this DNA? (b) The DNA is found to have 12 left-handed superhelical turns. What is the superhelix density o?
For some DNAs, it is possible to separate the two strands, after denaturation,in a CsCl gradient.(a) What property of any DNA determines where it will band in a CsClgradient?(b) What kind of DNA might have two strands that differ sufficiently in thisproperty that they could be separated after denaturation?
The A and G compositions (mole percent) of one of the strands of a duplex DNA is A = 27 and G = 30. (a) What would be the T and C compositions of the complementary strand? (b) What can be said about the A and G compositions of its complementary strand?